Incidental Mutation 'R9329:Aff4'
ID 706737
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9329 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53397859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 401 (T401A)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: T401A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: T401A

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470
AA Change: T101A

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T G 6: 83,156,574 M1R probably null Het
4932415D10Rik G A 10: 82,285,605 S3857L probably benign Het
Acap2 T C 16: 31,127,420 D235G probably damaging Het
Adgrv1 C A 13: 81,499,122 V3100F probably damaging Het
Apcs T C 1: 172,894,824 T22A probably benign Het
Atf7ip2 T C 16: 10,241,874 V426A possibly damaging Het
Bach2 A G 4: 32,562,175 D214G possibly damaging Het
Baz2a C T 10: 128,125,056 A1578V possibly damaging Het
Camk1d T C 2: 5,445,143 I76V probably benign Het
Ccdc182 A T 11: 88,294,498 M135L probably benign Het
Cd47 C T 16: 49,896,368 T201I Het
Chodl T C 16: 78,949,142 S290P possibly damaging Het
Chst15 A G 7: 132,266,791 L300P possibly damaging Het
Ciita T C 16: 10,506,707 S168P probably damaging Het
Cntn2 C T 1: 132,528,940 V123I probably benign Het
Cyld T A 8: 88,730,720 L527Q probably benign Het
Dbn1 T A 13: 55,483,428 Y34F probably damaging Het
Enc1 C A 13: 97,246,510 Y509* probably null Het
Ermard A T 17: 15,053,381 E409D probably benign Het
Extl3 T C 14: 65,077,316 E139G possibly damaging Het
Fa2h A T 8: 111,355,483 V177E possibly damaging Het
Flot2 T C 11: 78,058,946 I367T probably damaging Het
Fras1 T C 5: 96,736,954 Y2564H probably damaging Het
Fxyd3 A G 7: 31,073,593 V10A probably benign Het
Gfra3 A G 18: 34,704,507 L146P probably damaging Het
Gm49359 T C 13: 62,454,634 N251D probably benign Het
Hps6 A G 19: 46,004,103 S160G probably benign Het
Hsd17b7 C A 1: 169,967,306 A55S probably damaging Het
Hspa12a T C 19: 58,800,866 D446G probably benign Het
Htt G A 5: 34,832,613 R1163Q possibly damaging Het
Ift81 T C 5: 122,559,770 probably null Het
Ighv5-15 T G 12: 113,826,775 Y75S probably benign Het
Kcnd2 T A 6: 21,725,982 H491Q probably damaging Het
Lamb3 C A 1: 193,332,357 T608K probably benign Het
Lrtm2 T A 6: 119,320,451 K210* probably null Het
Med13 G T 11: 86,298,457 P1209T probably benign Het
Mtus1 G A 8: 41,084,202 T159I probably damaging Het
Myt1l A G 12: 29,851,660 M805V unknown Het
Neb G T 2: 52,270,219 L2261I probably benign Het
Nlrp4c G A 7: 6,065,499 R133H probably benign Het
Nol11 A T 11: 107,180,939 L276Q probably damaging Het
Nrap A G 19: 56,361,845 Y614H probably damaging Het
Olfr656 A G 7: 104,618,498 H273R probably damaging Het
Pou2f3 A G 9: 43,128,929 S355P probably damaging Het
Ppm1l C A 3: 69,553,120 N343K probably damaging Het
Prh1 A T 6: 132,571,610 I27F unknown Het
Prkrip1 A T 5: 136,194,349 L85Q probably damaging Het
Pycrl C T 15: 75,918,714 V99I probably benign Het
R3hdm4 T A 10: 79,913,559 N72I probably damaging Het
Rab11fip3 G T 17: 26,012,058 H738N probably benign Het
Rtl1 G A 12: 109,590,239 A1722V possibly damaging Het
Sell A G 1: 164,065,553 N113D probably damaging Het
Smarcal1 T C 1: 72,626,538 S732P probably damaging Het
Smurf2 A T 11: 106,852,598 D207E probably benign Het
Tat C T 8: 109,996,878 R333C probably benign Het
Tmem121b A T 6: 120,492,273 F494L probably damaging Het
Tmem198 C A 1: 75,479,878 P89Q probably damaging Het
Tnks2 T G 19: 36,857,884 C2G probably damaging Het
Trappc9 T C 15: 72,801,353 E869G unknown Het
Trim42 T A 9: 97,369,531 K105M probably benign Het
Ttll3 T C 6: 113,392,674 S60P probably benign Het
Ttll4 T A 1: 74,685,962 I625N possibly damaging Het
Tubgcp5 T A 7: 55,829,433 probably null Het
Txlnb A T 10: 17,806,846 Y172F probably damaging Het
Ube2e3 A T 2: 78,913,691 D88V possibly damaging Het
Vmn1r189 T A 13: 22,102,260 I136L probably benign Het
Vmn2r71 A G 7: 85,618,742 I135V probably benign Het
Vmn2r73 T A 7: 85,869,865 R516S probably benign Het
Wrn C T 8: 33,240,978 E1352K probably benign Het
Zfp318 T C 17: 46,411,213 S1381P probably damaging Het
Zfp747 A T 7: 127,374,483 Y172N probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGCATTGAACTAGGCAAACTCTG -3'
(R):5'- CCCAAAAGTCTCTGGTGTACC -3'

Sequencing Primer
(F):5'- CAGTTTCACTAAGGCCCAGGTAG -3'
(R):5'- CAAAAGTCTCTGGTGTACCATTCTG -3'
Posted On 2022-04-18