Incidental Mutation 'R9329:Hps6'
ID 706764
Institutional Source Beutler Lab
Gene Symbol Hps6
Ensembl Gene ENSMUSG00000074811
Gene Name HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms 5330434M19Rik, BLOC-2, ruby eye, ru
Accession Numbers

MGI: 2181763

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9329 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46003478-46006173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46004103 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 160 (S160G)
Ref Sequence ENSEMBL: ENSMUSP00000096991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099393]
AlphaFold Q8BLY7
Predicted Effect probably benign
Transcript: ENSMUST00000099393
AA Change: S160G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096991
Gene: ENSMUSG00000074811
AA Change: S160G

DomainStartEndE-ValueType
Pfam:HPS6 1 772 1e-281 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in hypopigmented hair and eyes, and increased clotting time due to a platelet dense granule defect. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Spontaneous(8) Chemically induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T G 6: 83,156,574 M1R probably null Het
4932415D10Rik G A 10: 82,285,605 S3857L probably benign Het
Acap2 T C 16: 31,127,420 D235G probably damaging Het
Adgrv1 C A 13: 81,499,122 V3100F probably damaging Het
Aff4 A G 11: 53,397,859 T401A probably damaging Het
Apcs T C 1: 172,894,824 T22A probably benign Het
Atf7ip2 T C 16: 10,241,874 V426A possibly damaging Het
Bach2 A G 4: 32,562,175 D214G possibly damaging Het
Baz2a C T 10: 128,125,056 A1578V possibly damaging Het
Camk1d T C 2: 5,445,143 I76V probably benign Het
Ccdc182 A T 11: 88,294,498 M135L probably benign Het
Cd47 C T 16: 49,896,368 T201I Het
Chodl T C 16: 78,949,142 S290P possibly damaging Het
Chst15 A G 7: 132,266,791 L300P possibly damaging Het
Ciita T C 16: 10,506,707 S168P probably damaging Het
Cntn2 C T 1: 132,528,940 V123I probably benign Het
Cyld T A 8: 88,730,720 L527Q probably benign Het
Dbn1 T A 13: 55,483,428 Y34F probably damaging Het
Enc1 C A 13: 97,246,510 Y509* probably null Het
Ermard A T 17: 15,053,381 E409D probably benign Het
Extl3 T C 14: 65,077,316 E139G possibly damaging Het
Fa2h A T 8: 111,355,483 V177E possibly damaging Het
Flot2 T C 11: 78,058,946 I367T probably damaging Het
Fras1 T C 5: 96,736,954 Y2564H probably damaging Het
Fxyd3 A G 7: 31,073,593 V10A probably benign Het
Gfra3 A G 18: 34,704,507 L146P probably damaging Het
Gm49359 T C 13: 62,454,634 N251D probably benign Het
Hsd17b7 C A 1: 169,967,306 A55S probably damaging Het
Hspa12a T C 19: 58,800,866 D446G probably benign Het
Htt G A 5: 34,832,613 R1163Q possibly damaging Het
Ift81 T C 5: 122,559,770 probably null Het
Ighv5-15 T G 12: 113,826,775 Y75S probably benign Het
Kcnd2 T A 6: 21,725,982 H491Q probably damaging Het
Lamb3 C A 1: 193,332,357 T608K probably benign Het
Lrtm2 T A 6: 119,320,451 K210* probably null Het
Med13 G T 11: 86,298,457 P1209T probably benign Het
Mtus1 G A 8: 41,084,202 T159I probably damaging Het
Myt1l A G 12: 29,851,660 M805V unknown Het
Neb G T 2: 52,270,219 L2261I probably benign Het
Nlrp4c G A 7: 6,065,499 R133H probably benign Het
Nol11 A T 11: 107,180,939 L276Q probably damaging Het
Nrap A G 19: 56,361,845 Y614H probably damaging Het
Olfr656 A G 7: 104,618,498 H273R probably damaging Het
Pou2f3 A G 9: 43,128,929 S355P probably damaging Het
Ppm1l C A 3: 69,553,120 N343K probably damaging Het
Prh1 A T 6: 132,571,610 I27F unknown Het
Prkrip1 A T 5: 136,194,349 L85Q probably damaging Het
Pycrl C T 15: 75,918,714 V99I probably benign Het
R3hdm4 T A 10: 79,913,559 N72I probably damaging Het
Rab11fip3 G T 17: 26,012,058 H738N probably benign Het
Rtl1 G A 12: 109,590,239 A1722V possibly damaging Het
Sell A G 1: 164,065,553 N113D probably damaging Het
Smarcal1 T C 1: 72,626,538 S732P probably damaging Het
Smurf2 A T 11: 106,852,598 D207E probably benign Het
Tat C T 8: 109,996,878 R333C probably benign Het
Tmem121b A T 6: 120,492,273 F494L probably damaging Het
Tmem198 C A 1: 75,479,878 P89Q probably damaging Het
Tnks2 T G 19: 36,857,884 C2G probably damaging Het
Trappc9 T C 15: 72,801,353 E869G unknown Het
Trim42 T A 9: 97,369,531 K105M probably benign Het
Ttll3 T C 6: 113,392,674 S60P probably benign Het
Ttll4 T A 1: 74,685,962 I625N possibly damaging Het
Tubgcp5 T A 7: 55,829,433 probably null Het
Txlnb A T 10: 17,806,846 Y172F probably damaging Het
Ube2e3 A T 2: 78,913,691 D88V possibly damaging Het
Vmn1r189 T A 13: 22,102,260 I136L probably benign Het
Vmn2r71 A G 7: 85,618,742 I135V probably benign Het
Vmn2r73 T A 7: 85,869,865 R516S probably benign Het
Wrn C T 8: 33,240,978 E1352K probably benign Het
Zfp318 T C 17: 46,411,213 S1381P probably damaging Het
Zfp747 A T 7: 127,374,483 Y172N probably damaging Het
Other mutations in Hps6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hps6 APN 19 46003660 missense probably damaging 1.00
IGL02826:Hps6 APN 19 46006041 makesense probably null
stamper-coat UTSW 19 46003836 missense probably damaging 1.00
R0299:Hps6 UTSW 19 46004232 missense probably damaging 0.98
R0613:Hps6 UTSW 19 46003821 missense probably benign
R1036:Hps6 UTSW 19 46004241 missense probably benign 0.00
R1845:Hps6 UTSW 19 46004970 missense probably benign 0.30
R1959:Hps6 UTSW 19 46004335 missense probably benign 0.33
R2271:Hps6 UTSW 19 46005682 missense possibly damaging 0.86
R2332:Hps6 UTSW 19 46004491 missense possibly damaging 0.82
R3156:Hps6 UTSW 19 46003741 missense probably damaging 1.00
R3937:Hps6 UTSW 19 46004053 missense probably damaging 0.97
R7108:Hps6 UTSW 19 46005490 missense probably damaging 1.00
R7384:Hps6 UTSW 19 46004017 missense possibly damaging 0.96
R7710:Hps6 UTSW 19 46004568 missense probably benign 0.03
R8444:Hps6 UTSW 19 46005428 missense possibly damaging 0.72
R8530:Hps6 UTSW 19 46003520 start gained probably benign
R8773:Hps6 UTSW 19 46005702 missense possibly damaging 0.92
R8868:Hps6 UTSW 19 46004007 missense possibly damaging 0.89
R9385:Hps6 UTSW 19 46005910 missense probably damaging 0.97
X0065:Hps6 UTSW 19 46004166 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCGCCACTTGCTGCTATTAAG -3'
(R):5'- TTGCTTGGGCTCCAGATGAG -3'

Sequencing Primer
(F):5'- ACCCGCGCTGATCTTGGTATG -3'
(R):5'- CTCCAGATGAGCAGAAGGTG -3'
Posted On 2022-04-18