Incidental Mutation 'R0741:Cryba4'
ID70680
Institutional Source Beutler Lab
Gene Symbol Cryba4
Ensembl Gene ENSMUSG00000066975
Gene Namecrystallin, beta A4
Synonyms
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location112246493-112252518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112246688 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 192 (R192C)
Ref Sequence ENSEMBL: ENSMUSP00000108004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086629] [ENSMUST00000112383] [ENSMUST00000112385]
Predicted Effect probably damaging
Transcript: ENSMUST00000086629
AA Change: R192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083826
Gene: ENSMUSG00000066975
AA Change: R192C

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112383
AA Change: R179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108002
Gene: ENSMUSG00000066975
AA Change: R179C

DomainStartEndE-ValueType
XTALbg 1 84 1.71e-35 SMART
XTALbg 93 181 2.59e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112385
AA Change: R192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108004
Gene: ENSMUSG00000066975
AA Change: R192C

DomainStartEndE-ValueType
XTALbg 13 97 1.08e-37 SMART
XTALbg 106 194 2.59e-35 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the crystallin family of proteins that contribute to the transparency and refractive properties of the ocular lens. Certain mutations in the human ortholog of this gene are associated with cataract and bilateral microphthalmia. This gene is located adjacent to a related crystallin gene on chromosome 5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Cryba4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Cryba4 APN 5 112251009 unclassified probably benign
R5622:Cryba4 UTSW 5 112251124 missense probably damaging 1.00
R5811:Cryba4 UTSW 5 112251071 missense probably benign
R6644:Cryba4 UTSW 5 112246762 missense probably damaging 1.00
R7008:Cryba4 UTSW 5 112251782 missense probably benign
R7554:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7556:Cryba4 UTSW 5 112251103 missense probably damaging 0.99
R7671:Cryba4 UTSW 5 112248173 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGGGACACAGTTGATACTGAGTC -3'
(R):5'- CCTAAAGAACAGCCTTGGGTGTGG -3'

Sequencing Primer
(F):5'- GACACAGTTGATACTGAGTCTTTTG -3'
(R):5'- CAGGGCCATGAAGCTCAC -3'
Posted On2013-09-30