Incidental Mutation 'R9331:Hyal4'
ID 706839
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Name hyaluronoglucosaminidase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9331 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 24748329-24767662 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24765867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 407 (I407L)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
AlphaFold Q05A56
Predicted Effect probably damaging
Transcript: ENSMUST00000031691
AA Change: I407L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: I407L

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,709 R797G probably benign Het
Abca3 A G 17: 24,397,350 E922G probably benign Het
Abca8a A G 11: 110,026,328 L1615P probably damaging Het
Actrt3 T C 3: 30,597,901 D348G probably damaging Het
Adam3 A G 8: 24,687,935 M654T probably benign Het
Adamts8 A T 9: 30,951,474 H325L probably damaging Het
Agpat2 A G 2: 26,597,306 Y72H probably benign Het
Ap3m1 A G 14: 21,045,598 Y55H possibly damaging Het
Cacna1a C T 8: 84,415,817 A58V probably damaging Het
Cacna1c C T 6: 119,107,948 V10I Het
Ccnt1 T A 15: 98,543,216 K724* probably null Het
Cd72 T A 4: 43,454,320 T38S possibly damaging Het
Crispld1 T A 1: 17,762,230 I480K probably damaging Het
Diaph3 G T 14: 87,141,025 Y30* probably null Het
Ei24 A G 9: 36,789,921 I34T possibly damaging Het
Fdxacb1 G A 9: 50,770,211 S144N probably damaging Het
Fgf21 G T 7: 45,614,190 Q155K probably benign Het
Gdap1l1 A T 2: 163,453,744 R310S probably benign Het
Gm44501 G A 17: 40,578,729 V45I probably benign Het
Gne A G 4: 44,066,845 L56P probably damaging Het
Hcn4 T C 9: 58,860,422 S1089P probably damaging Het
Hexim1 C T 11: 103,117,148 T76M probably damaging Het
Hkdc1 A T 10: 62,400,335 L476* probably null Het
Hoxd8 CGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGC 2: 74,705,598 probably benign Het
Ighv5-9-1 T C 12: 113,736,258 Y78C possibly damaging Het
Kif20a T A 18: 34,629,509 C478* probably null Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Ltbp2 C T 12: 84,876,191 R34Q probably benign Het
Mccc1 A G 3: 35,960,089 V693A probably damaging Het
Muc5b C A 7: 141,857,738 Q1474K unknown Het
Nos1 T C 5: 117,900,524 V474A possibly damaging Het
Nprl2 G A 9: 107,544,756 V244M probably damaging Het
Npy2r A G 3: 82,540,761 S236P probably damaging Het
Olfr250 A G 9: 38,367,707 S44G probably benign Het
Olfr877 G A 9: 37,855,414 V199I probably benign Het
P2rx7 T C 5: 122,680,898 L461P probably benign Het
Pde12 T C 14: 26,668,673 I294V probably benign Het
Plcl1 T C 1: 55,696,871 L457P possibly damaging Het
Plekho2 C A 9: 65,556,584 A328S probably benign Het
Polg T C 7: 79,458,400 K556E probably damaging Het
Prl7a2 A G 13: 27,665,079 S76P probably damaging Het
Ptar1 T A 19: 23,694,343 C37S probably benign Het
Pwwp2b G A 7: 139,255,441 G266D probably damaging Het
Pygm T C 19: 6,398,099 F812L probably damaging Het
Smarcc2 A T 10: 128,487,441 T982S unknown Het
Syne1 C G 10: 5,123,666 V1226L probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem206 T C 1: 191,345,121 probably null Het
Tmub1 T C 5: 24,445,987 T225A probably damaging Het
Trmo A C 4: 46,387,642 C59W possibly damaging Het
Ttc6 C A 12: 57,673,723 A925D probably damaging Het
Tubb1 A G 2: 174,455,679 E27G probably damaging Het
Unkl G A 17: 25,231,749 C503Y probably damaging Het
Usp40 A G 1: 87,974,106 I785T probably damaging Het
Vmn2r32 G A 7: 7,464,403 Q709* probably null Het
Xaf1 T C 11: 72,306,644 S149P probably damaging Het
Ythdc2 T A 18: 44,837,432 V271E possibly damaging Het
Zfp386 C T 12: 116,047,813 probably benign Het
Zfp456 T A 13: 67,366,270 E439V probably damaging Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24765715 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24756111 missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3622:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6494:Hyal4 UTSW 6 24765746 missense possibly damaging 0.79
R6901:Hyal4 UTSW 6 24756191 missense probably damaging 0.97
R7565:Hyal4 UTSW 6 24765934 missense possibly damaging 0.77
R7973:Hyal4 UTSW 6 24755786 start codon destroyed probably null 0.99
R7977:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R7987:Hyal4 UTSW 6 24763866 missense probably damaging 0.99
R8020:Hyal4 UTSW 6 24755996 missense probably benign 0.14
R8676:Hyal4 UTSW 6 24755827 missense probably damaging 0.99
R9573:Hyal4 UTSW 6 24756509 missense possibly damaging 0.62
Z1176:Hyal4 UTSW 6 24756628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGTCTAAAGAGCTGCCTC -3'
(R):5'- CAGACACAGTGTTATTACAGAGC -3'

Sequencing Primer
(F):5'- GCCTCTGGCTCTATAACCTCTGATC -3'
(R):5'- ACACAGTGTTATTACAGAGCTAGAG -3'
Posted On 2022-04-18