Incidental Mutation 'R9331:Ighv5-9-1'
ID 706865
Institutional Source Beutler Lab
Gene Symbol Ighv5-9-1
Ensembl Gene ENSMUSG00000095210
Gene Name immunoglobulin heavy variable 5-9-1
Synonyms Gm16886
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R9331 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113736111-113736630 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113736258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 78 (Y78C)
Ref Sequence ENSEMBL: ENSMUSP00000141243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103452] [ENSMUST00000192264]
AlphaFold A0A075B5Q6
Predicted Effect possibly damaging
Transcript: ENSMUST00000103452
AA Change: Y68C

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100233
Gene: ENSMUSG00000095210
AA Change: Y68C

DomainStartEndE-ValueType
IGv 35 116 8.34e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192264
AA Change: Y78C

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141243
Gene: ENSMUSG00000095210
AA Change: Y78C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGv 45 126 3.3e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,709 R797G probably benign Het
Abca3 A G 17: 24,397,350 E922G probably benign Het
Abca8a A G 11: 110,026,328 L1615P probably damaging Het
Actrt3 T C 3: 30,597,901 D348G probably damaging Het
Adam3 A G 8: 24,687,935 M654T probably benign Het
Adamts8 A T 9: 30,951,474 H325L probably damaging Het
Agpat2 A G 2: 26,597,306 Y72H probably benign Het
Ap3m1 A G 14: 21,045,598 Y55H possibly damaging Het
Cacna1a C T 8: 84,415,817 A58V probably damaging Het
Cacna1c C T 6: 119,107,948 V10I Het
Ccnt1 T A 15: 98,543,216 K724* probably null Het
Cd72 T A 4: 43,454,320 T38S possibly damaging Het
Crispld1 T A 1: 17,762,230 I480K probably damaging Het
Diaph3 G T 14: 87,141,025 Y30* probably null Het
Ei24 A G 9: 36,789,921 I34T possibly damaging Het
Fdxacb1 G A 9: 50,770,211 S144N probably damaging Het
Fgf21 G T 7: 45,614,190 Q155K probably benign Het
Gdap1l1 A T 2: 163,453,744 R310S probably benign Het
Gm44501 G A 17: 40,578,729 V45I probably benign Het
Gne A G 4: 44,066,845 L56P probably damaging Het
Hcn4 T C 9: 58,860,422 S1089P probably damaging Het
Hexim1 C T 11: 103,117,148 T76M probably damaging Het
Hkdc1 A T 10: 62,400,335 L476* probably null Het
Hoxd8 CGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGC 2: 74,705,598 probably benign Het
Hyal4 A T 6: 24,765,867 I407L probably damaging Het
Kif20a T A 18: 34,629,509 C478* probably null Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Ltbp2 C T 12: 84,876,191 R34Q probably benign Het
Mccc1 A G 3: 35,960,089 V693A probably damaging Het
Muc5b C A 7: 141,857,738 Q1474K unknown Het
Nos1 T C 5: 117,900,524 V474A possibly damaging Het
Nprl2 G A 9: 107,544,756 V244M probably damaging Het
Npy2r A G 3: 82,540,761 S236P probably damaging Het
Olfr250 A G 9: 38,367,707 S44G probably benign Het
Olfr877 G A 9: 37,855,414 V199I probably benign Het
P2rx7 T C 5: 122,680,898 L461P probably benign Het
Pde12 T C 14: 26,668,673 I294V probably benign Het
Plcl1 T C 1: 55,696,871 L457P possibly damaging Het
Plekho2 C A 9: 65,556,584 A328S probably benign Het
Polg T C 7: 79,458,400 K556E probably damaging Het
Prl7a2 A G 13: 27,665,079 S76P probably damaging Het
Ptar1 T A 19: 23,694,343 C37S probably benign Het
Pwwp2b G A 7: 139,255,441 G266D probably damaging Het
Pygm T C 19: 6,398,099 F812L probably damaging Het
Smarcc2 A T 10: 128,487,441 T982S unknown Het
Syne1 C G 10: 5,123,666 V1226L probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmem206 T C 1: 191,345,121 probably null Het
Tmub1 T C 5: 24,445,987 T225A probably damaging Het
Trmo A C 4: 46,387,642 C59W possibly damaging Het
Ttc6 C A 12: 57,673,723 A925D probably damaging Het
Tubb1 A G 2: 174,455,679 E27G probably damaging Het
Unkl G A 17: 25,231,749 C503Y probably damaging Het
Usp40 A G 1: 87,974,106 I785T probably damaging Het
Vmn2r32 G A 7: 7,464,403 Q709* probably null Het
Xaf1 T C 11: 72,306,644 S149P probably damaging Het
Ythdc2 T A 18: 44,837,432 V271E possibly damaging Het
Zfp386 C T 12: 116,047,813 probably benign Het
Zfp456 T A 13: 67,366,270 E439V probably damaging Het
Other mutations in Ighv5-9-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ighv5-9-1 APN 12 113736390 missense probably damaging 1.00
R4921:Ighv5-9-1 UTSW 12 113736294 missense possibly damaging 0.61
R5161:Ighv5-9-1 UTSW 12 113736157 missense possibly damaging 0.70
R5559:Ighv5-9-1 UTSW 12 113736125 nonsense probably null
R5678:Ighv5-9-1 UTSW 12 113736587 missense possibly damaging 0.72
R7529:Ighv5-9-1 UTSW 12 113736334 missense possibly damaging 0.91
R7618:Ighv5-9-1 UTSW 12 113736199 missense probably damaging 0.99
R7791:Ighv5-9-1 UTSW 12 113736545 missense probably damaging 0.99
R9272:Ighv5-9-1 UTSW 12 113736198 missense probably damaging 1.00
Z1088:Ighv5-9-1 UTSW 12 113736120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCCATATGCTCTCTGCG -3'
(R):5'- CTCTGTTTGCAGGTGTCCAG -3'

Sequencing Primer
(F):5'- GGTTTTAGTTTGAGCTCACAGTAAC -3'
(R):5'- TCCAGTGTGACGTGAAGC -3'
Posted On 2022-04-18