Mutagenetix > Incidental Mutations

Incidental Mutation 'R0741:Iqgap1'

70687

Institutional Source

Beutler Lab

Gene Symbol

Iqgap1

Ensembl Gene

ENSMUSG00000030536

Gene Name

IQ motif containing GTPase activating protein 1

Synonyms

D7Ertd237e, D7Ertd257e

MMRRC Submission

038922-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80711583-80825974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80720987 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1545 (S1545P)

Ref Sequence

ENSEMBL: ENSMUSP00000128278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167377]

Predicted Effect

probably benign
Transcript: ENSMUST00000167377
AA Change: S1545P

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: S1545P

Domain	Start	End	E-Value	Type
CH	46	155	2.02e-20	SMART
internal_repeat_1	203	278	3.71e-8	PROSPERO
low complexity region	324	335	N/A	INTRINSIC
low complexity region	390	399	N/A	INTRINSIC
coiled coil region	488	515	N/A	INTRINSIC
internal_repeat_1	608	684	3.71e-8	PROSPERO
IQ	744	766	3.85e-3	SMART
IQ	774	796	1.12e-4	SMART
IQ	804	826	1.32e-1	SMART
IQ	834	856	1.15e1	SMART
coiled coil region	886	914	N/A	INTRINSIC
RasGAP	992	1345	7.46e-89	SMART
Pfam:RasGAP_C	1452	1580	4.5e-41	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano7	T	A	1: 93,401,587	I701N	probably damaging	Het
Asb7	A	T	7: 66,660,134	N111K	probably benign	Het
Atp10a	T	A	7: 58,828,589	L1460Q	possibly damaging	Het
Auh	T	C	13: 52,929,602	T14A	possibly damaging	Het
Caskin2	A	G	11: 115,804,800	V245A	probably damaging	Het
Cryba4	G	A	5: 112,246,688	R192C	probably damaging	Het
Ctsq	T	A	13: 61,036,205	D301V	probably damaging	Het
Dpyd	A	G	3: 118,674,505	E56G	possibly damaging	Het
Dtd2	T	C	12: 51,999,672	K128R	probably benign	Het
Eps8l3	A	G	3: 107,882,825	T141A	probably benign	Het
Evc	A	T	5: 37,326,395	I187N	possibly damaging	Het
Fam120a	A	G	13: 48,891,940	S807P	possibly damaging	Het
Fbxw22	G	A	9: 109,382,219	S338L	probably benign	Het
Gcnt4	G	T	13: 96,946,432	E79*	probably null	Het
Get4	G	A	5: 139,263,629		probably benign	Het
Hipk1	A	G	3: 103,746,812	V954A	probably benign	Het
Ifi206	C	T	1: 173,473,749	V788M	probably benign	Het
Kif21b	A	G	1: 136,159,744	T933A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Magee2	A	G	X: 104,855,866	L393P	probably damaging	Het
Mtrr	T	C	13: 68,579,539		probably null	Het
Nes	A	G	3: 87,978,967	E1467G	probably damaging	Het
Nol3	C	G	8: 105,279,124	A50G	probably damaging	Het
Nr2f2	G	A	7: 70,357,997	R113C	probably damaging	Het
Obscn	CCACACACACACAC	CCACACACACAC	11: 59,063,453		probably null	Het
Olfr512	T	A	7: 108,713,604	C84S	probably benign	Het
Pnkd	T	A	1: 74,351,859	S337R	possibly damaging	Het
Ptprh	A	G	7: 4,554,173		probably null	Het
Ralgapa1	A	C	12: 55,676,581	V1767G	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Skap1	A	C	11: 96,492,933		probably benign	Het
Trip12	A	G	1: 84,745,181	S1250P	probably benign	Het
Txndc5	T	C	13: 38,528,260	H50R	possibly damaging	Het
Usp25	C	A	16: 77,071,708	D332E	possibly damaging	Het
Vgll1	A	T	X: 57,096,284		probably benign	Het

Other mutations in Iqgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Iqgap1	APN	7	80759844	missense	probably benign	0.00
IGL00984:Iqgap1	APN	7	80726798	missense	probably damaging	1.00
IGL01570:Iqgap1	APN	7	80723061	missense	possibly damaging	0.76
IGL01738:Iqgap1	APN	7	80723900	missense	possibly damaging	0.80
IGL02141:Iqgap1	APN	7	80738121	missense	probably damaging	1.00
IGL02336:Iqgap1	APN	7	80752293	missense	probably benign	0.39
IGL02416:Iqgap1	APN	7	80726038	missense	probably damaging	1.00
IGL02597:Iqgap1	APN	7	80723885	missense	probably damaging	1.00
IGL02662:Iqgap1	APN	7	80743079	missense	probably benign
IGL03157:Iqgap1	APN	7	80751888	missense	probably benign	0.34
IGL03189:Iqgap1	APN	7	80713842	missense	probably benign	0.12
IGL03216:Iqgap1	APN	7	80743088	missense	probably benign	0.33
R0024:Iqgap1	UTSW	7	80751939	missense	probably benign
R0126:Iqgap1	UTSW	7	80738322	missense	probably benign	0.00
R0144:Iqgap1	UTSW	7	80751920	missense	probably damaging	1.00
R0325:Iqgap1	UTSW	7	80751930	missense	probably benign	0.01
R0376:Iqgap1	UTSW	7	80723879	missense	probably benign	0.01
R0650:Iqgap1	UTSW	7	80736395	missense	probably damaging	1.00
R0652:Iqgap1	UTSW	7	80736395	missense	probably damaging	1.00
R0751:Iqgap1	UTSW	7	80725573	unclassified	probably benign
R1067:Iqgap1	UTSW	7	80723828	missense	probably benign	0.01
R1389:Iqgap1	UTSW	7	80759756	critical splice donor site	probably null
R1473:Iqgap1	UTSW	7	80734011	missense	probably benign	0.00
R1613:Iqgap1	UTSW	7	80768457	missense	probably damaging	1.00
R1842:Iqgap1	UTSW	7	80760883	missense	probably damaging	1.00
R1909:Iqgap1	UTSW	7	80743828	missense	probably benign
R2062:Iqgap1	UTSW	7	80723979	nonsense	probably null
R2149:Iqgap1	UTSW	7	80762560	missense	probably damaging	1.00
R2153:Iqgap1	UTSW	7	80751953	missense	probably benign	0.00
R2153:Iqgap1	UTSW	7	80759903	missense	possibly damaging	0.55
R3160:Iqgap1	UTSW	7	80752338	missense	probably benign
R3162:Iqgap1	UTSW	7	80752338	missense	probably benign
R3605:Iqgap1	UTSW	7	80723789	missense	probably benign	0.02
R3709:Iqgap1	UTSW	7	80717087	missense	possibly damaging	0.87
R3935:Iqgap1	UTSW	7	80743837	missense	possibly damaging	0.54
R3979:Iqgap1	UTSW	7	80759934	missense	probably damaging	0.98
R4545:Iqgap1	UTSW	7	80762567	critical splice acceptor site	probably null
R4787:Iqgap1	UTSW	7	80735513	missense	probably damaging	1.00
R4925:Iqgap1	UTSW	7	80765317	missense	probably damaging	1.00
R4953:Iqgap1	UTSW	7	80723776	splice site	probably null
R5037:Iqgap1	UTSW	7	80734100	missense	probably damaging	1.00
R5158:Iqgap1	UTSW	7	80743068	missense	probably benign	0.02
R5183:Iqgap1	UTSW	7	80723065	missense	probably damaging	1.00
R5262:Iqgap1	UTSW	7	80726742	missense	probably benign	0.00
R5271:Iqgap1	UTSW	7	80734148	missense	probably damaging	1.00
R5289:Iqgap1	UTSW	7	80738724	missense	possibly damaging	0.88
R5359:Iqgap1	UTSW	7	80766959	missense	probably benign	0.00
R5423:Iqgap1	UTSW	7	80799862	missense	probably damaging	1.00
R5843:Iqgap1	UTSW	7	80726080	missense	probably benign	0.03
R5849:Iqgap1	UTSW	7	80803158	missense	probably benign
R6164:Iqgap1	UTSW	7	80809106	missense	unknown
R6315:Iqgap1	UTSW	7	80799890	missense	possibly damaging	0.65
R6335:Iqgap1	UTSW	7	80728024	missense	probably damaging	1.00
R6488:Iqgap1	UTSW	7	80730326	missense	probably benign	0.00
R6723:Iqgap1	UTSW	7	80723822	missense	probably benign	0.01
R6800:Iqgap1	UTSW	7	80728981	missense	possibly damaging	0.56
R6815:Iqgap1	UTSW	7	80766884	critical splice donor site	probably null
R7240:Iqgap1	UTSW	7	80759839	missense	probably benign	0.22
R7386:Iqgap1	UTSW	7	80726042	missense	probably damaging	1.00
R7387:Iqgap1	UTSW	7	80720990	missense	probably benign	0.03
R7410:Iqgap1	UTSW	7	80723030	nonsense	probably null
R7429:Iqgap1	UTSW	7	80751440	missense	probably benign	0.00
R7452:Iqgap1	UTSW	7	80760829	missense	possibly damaging	0.80
R7615:Iqgap1	UTSW	7	80730100	missense	probably damaging	1.00
R7615:Iqgap1	UTSW	7	80751346	missense	probably benign
R7726:Iqgap1	UTSW	7	80757456	missense	probably benign	0.37
R7783:Iqgap1	UTSW	7	80809059	missense	probably benign	0.01
R7785:Iqgap1	UTSW	7	80738169	missense	probably damaging	1.00
R7862:Iqgap1	UTSW	7	80743888	missense	probably benign	0.04
R8270:Iqgap1	UTSW	7	80730127	missense	probably damaging	1.00
R8556:Iqgap1	UTSW	7	80726039	missense	probably damaging	1.00
RF004:Iqgap1	UTSW	7	80720875	missense	probably benign
RF063:Iqgap1	UTSW	7	80723751	frame shift	probably null
X0064:Iqgap1	UTSW	7	80720931	nonsense	probably null
X0067:Iqgap1	UTSW	7	80766903	missense	probably benign
Z1176:Iqgap1	UTSW	7	80768309	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACACACGATAAGGTGGAGTGTGAA -3'
(R):5'- TGGAAGTGCATGGGCGACAG -3'

Sequencing Primer
(F):5'- ttctctctctctctctctctctc -3'
(R):5'- ACAGAAGTTGTCTGTCACGGTC -3'

Posted On

2013-09-30