Incidental Mutation 'R9332:Myh7b'
ID 706895
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Name myosin, heavy chain 7B, cardiac muscle, beta
Synonyms Myh14
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155611212-155634307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 155628802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1057 (R1057C)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
AlphaFold A2AQP0
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: R1057C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: R1057C

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 37,050,840 D1485N Het
Ankrd55 T G 13: 112,323,143 D90E probably damaging Het
Arid1b C A 17: 4,995,309 P124Q unknown Het
Atxn2 C T 5: 121,785,362 P698L probably damaging Het
B020004J07Rik C T 4: 101,837,947 V56M probably damaging Het
Bend7 T C 2: 4,752,720 V191A probably benign Het
C2cd4a T G 9: 67,831,497 H88P probably damaging Het
Cacna1s C T 1: 136,092,714 Q830* probably null Het
Camta1 T C 4: 151,144,017 E786G possibly damaging Het
Caprin1 A G 2: 103,773,045 S443P probably benign Het
Cass4 T G 2: 172,427,886 F629L probably benign Het
Ccdc149 T A 5: 52,405,057 D209V probably damaging Het
Ccdc150 T C 1: 54,277,751 V263A probably damaging Het
Cfc1 C T 1: 34,537,372 R145C probably damaging Het
Cnn1 C A 9: 22,108,054 D239E probably damaging Het
Cobll1 C T 2: 65,103,172 S493N probably benign Het
Cox20 A T 1: 178,319,206 K13* probably null Het
Dclk1 G A 3: 55,463,079 S340N probably damaging Het
Dennd2c T A 3: 103,131,561 D8E probably benign Het
Dnajc10 A T 2: 80,344,983 K571N probably benign Het
Dock7 T A 4: 99,008,043 I58F Het
Dpy19l4 A G 4: 11,304,298 probably null Het
Eef2k A G 7: 120,884,695 D218G probably benign Het
Eya4 G T 10: 23,113,946 T504K probably damaging Het
Fam222a T C 5: 114,611,337 I198T probably damaging Het
Fbxw10 T A 11: 62,857,759 F404Y probably benign Het
Fbxw24 A T 9: 109,623,613 Y105N probably damaging Het
Fzd10 T G 5: 128,601,252 L12R possibly damaging Het
Gm14443 A G 2: 175,175,817 probably benign Het
Gm21028 A T 7: 42,578,480 C37S probably damaging Het
Gpr179 G T 11: 97,338,725 A868E probably damaging Het
Greb1l T A 18: 10,532,796 Y897N possibly damaging Het
Grid1 A T 14: 35,323,403 Y401F probably benign Het
Heatr5a G A 12: 51,899,285 T1181I probably benign Het
Herc4 G A 10: 63,308,346 V753I probably damaging Het
Htra1 A T 7: 130,962,121 K241* probably null Het
Kat6b A G 14: 21,670,025 I1482V probably benign Het
Kif19a G T 11: 114,789,207 R790L possibly damaging Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Lpcat1 T C 13: 73,511,343 L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 R94W probably damaging Het
Map4 A G 9: 110,035,155 T483A probably benign Het
Mettl3 C A 14: 52,296,668 C483F probably damaging Het
Myh13 A G 11: 67,363,283 D1543G possibly damaging Het
Myh2 G A 11: 67,179,383 V414I probably damaging Het
Myo9b A G 8: 71,359,602 S2006G probably benign Het
Nelfcd A G 2: 174,423,185 K239R probably benign Het
Nlrp4a T C 7: 26,459,652 S786P probably damaging Het
Olfr1000 T A 2: 85,607,987 K308* probably null Het
Olfr775 A G 10: 129,251,103 T190A probably damaging Het
Pdzrn4 G T 15: 92,397,335 V141L probably benign Het
Phip G T 9: 82,875,359 R1587S probably damaging Het
Plce1 A G 19: 38,737,933 E1448G probably damaging Het
Plrg1 T C 3: 83,069,001 S326P possibly damaging Het
Pom121l2 T A 13: 21,981,682 V41E probably damaging Het
Preb G T 5: 30,956,329 S311* probably null Het
Prss33 T A 17: 23,834,749 D118V probably damaging Het
Pum1 C A 4: 130,771,898 Y1008* probably null Het
Rassf2 G A 2: 132,004,406 R144C probably damaging Het
Rnf123 A T 9: 108,067,505 M429K probably benign Het
Rtl1 T A 12: 109,590,857 H1516L probably benign Het
Scyl3 T A 1: 163,936,438 N124K probably damaging Het
Sec24b A G 3: 130,007,571 S488P probably benign Het
Shc4 T A 2: 125,678,698 D277V probably damaging Het
Sorl1 T A 9: 42,001,518 D1389V probably damaging Het
Srcap T A 7: 127,559,640 I2896N unknown Het
Steap3 T A 1: 120,227,834 Y465F probably benign Het
Tecta C A 9: 42,372,897 C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem178b G A 6: 40,004,247 W72* probably null Het
Tmem235 T G 11: 117,860,839 Y30D probably damaging Het
Tpst1 C A 5: 130,134,460 T366K probably benign Het
Trdv2-1 C A 14: 53,946,391 P27T probably benign Het
Trim37 G T 11: 87,167,502 L335F possibly damaging Het
Usp9y G A Y: 1,341,873 R1331W probably damaging Het
Vmn1r1 T G 1: 182,157,437 H221P probably damaging Het
Vmn2r6 A T 3: 64,547,250 S543T probably benign Het
Wdpcp C T 11: 21,711,522 P265S probably benign Het
Wdr64 T C 1: 175,772,305 L566P possibly damaging Het
Zfp248 A G 6: 118,428,930 I566T possibly damaging Het
Zfp595 T A 13: 67,317,399 I270F probably damaging Het
Zfp715 A G 7: 43,299,423 L371P probably damaging Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
Irrational UTSW 2 155630672 unclassified probably benign
Muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
R7652:Myh7b UTSW 2 155632236 missense probably damaging 0.99
R7678:Myh7b UTSW 2 155617778 splice site probably null
R7703:Myh7b UTSW 2 155620436 missense probably null 1.00
R7711:Myh7b UTSW 2 155620403 missense probably damaging 1.00
R7923:Myh7b UTSW 2 155625966 missense probably benign
R7967:Myh7b UTSW 2 155614199 splice site probably null
R8045:Myh7b UTSW 2 155613181 missense probably benign 0.00
R8176:Myh7b UTSW 2 155625966 missense probably benign 0.06
R8272:Myh7b UTSW 2 155632904 missense probably damaging 1.00
R8560:Myh7b UTSW 2 155623204 missense possibly damaging 0.93
R8706:Myh7b UTSW 2 155611749 critical splice donor site probably null
R8824:Myh7b UTSW 2 155630381 missense probably benign 0.02
R8832:Myh7b UTSW 2 155633262 missense probably benign 0.00
R9079:Myh7b UTSW 2 155623254 missense probably damaging 0.97
R9151:Myh7b UTSW 2 155632519 missense probably damaging 1.00
R9311:Myh7b UTSW 2 155621333 missense probably damaging 1.00
R9357:Myh7b UTSW 2 155621348 missense probably damaging 1.00
R9388:Myh7b UTSW 2 155631063 missense probably benign 0.28
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGACACAGGTGAAGAAC -3'
(R):5'- GCCTCTGCTGTACATAGCTC -3'

Sequencing Primer
(F):5'- ACTGGATGAAGCCGTGGTC -3'
(R):5'- GCTGTACATAGCTCTGATCCAG -3'
Posted On 2022-04-18