Incidental Mutation 'R0741:Nol3'
ID70691
Institutional Source Beutler Lab
Gene Symbol Nol3
Ensembl Gene ENSMUSG00000014776
Gene Namenucleolar protein 3 (apoptosis repressor with CARD domain)
SynonymsARC, B430311C09Rik, Nop30
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105276140-105281939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 105279124 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 50 (A50G)
Ref Sequence ENSEMBL: ENSMUSP00000014920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014920] [ENSMUST00000014981] [ENSMUST00000036127] [ENSMUST00000163734] [ENSMUST00000171788] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837] [ENSMUST00000212219] [ENSMUST00000212922]
Predicted Effect probably damaging
Transcript: ENSMUST00000014920
AA Change: A50G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014920
Gene: ENSMUSG00000014776
AA Change: A50G

DomainStartEndE-ValueType
CARD 4 92 2.1e-27 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 173 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036127
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163734
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic protein that has been shown to down-regulate the enzyme activities of caspase 2, caspase 8 and tumor protein p53. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous null mice exhibit accelerated cardiomyopathy in response to pressure overload and increased myocardial infarct size after I/R injury. Mice homozygous for another knock-out allele exhibit attenuated pulmonary hypertension and vasculature remodeling response to chronic hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Nol3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Nol3 APN 8 105279631 missense probably benign 0.01
R1530:Nol3 UTSW 8 105279226 missense probably benign 0.03
R4766:Nol3 UTSW 8 105281933 utr 3 prime probably null
R4883:Nol3 UTSW 8 105279256 missense possibly damaging 0.77
R6838:Nol3 UTSW 8 105279575 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCGTAGAGTAACGCAAATTACGCC -3'
(R):5'- AATCCACGCCCTTCGATTCATCAAG -3'

Sequencing Primer
(F):5'- GCAAATTACGCCCCGCC -3'
(R):5'- TCGATTCATCAAGGCTCCAC -3'
Posted On2013-09-30