Incidental Mutation 'R0741:Fbxw22'
ID70692
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene NameF-box and WD-40 domain protein 22
SynonymsGm5164
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109378400-109404296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109382219 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 338 (S338L)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
Predicted Effect probably benign
Transcript: ENSMUST00000080626
AA Change: S338L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: S338L

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197213
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109384040 missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109382244 splice site probably benign
IGL01122:Fbxw22 APN 9 109386671 missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109381722 missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109384994 missense probably benign
IGL01486:Fbxw22 APN 9 109378873 missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109383925 missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109402019 missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109386551 splice site probably benign
IGL02466:Fbxw22 APN 9 109385092 missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109386664 missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109381685 missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109403096 missense possibly damaging 0.92
R1603:Fbxw22 UTSW 9 109378847 missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109382128 missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109385111 nonsense probably null
R2265:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2385:Fbxw22 UTSW 9 109382142 missense probably damaging 1.00
R4329:Fbxw22 UTSW 9 109384043 missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109378871 missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109378869 missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109383941 missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109403424 missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109385115 missense probably benign
R5319:Fbxw22 UTSW 9 109383947 missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109403088 missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109384996 missense probably benign 0.00
R5846:Fbxw22 UTSW 9 109386761 missense probably benign
R6002:Fbxw22 UTSW 9 109381682 nonsense probably null
R6180:Fbxw22 UTSW 9 109386679 missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109403397 missense probably damaging 0.99
R6860:Fbxw22 UTSW 9 109383962 missense probably benign 0.01
R6949:Fbxw22 UTSW 9 109382076 missense probably benign 0.06
R7084:Fbxw22 UTSW 9 109404223 missense probably damaging 1.00
R7296:Fbxw22 UTSW 9 109382075 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTTCCTTAGCAGCAGGCTTC -3'
(R):5'- ACACTGTCATGGACATGGACTTCAC -3'

Sequencing Primer
(F):5'- gggaaaacgaaagagactgac -3'
(R):5'- TGGACATGGACTTCACAGGAC -3'
Posted On2013-09-30