Incidental Mutation 'R9332:Eef2k'
ID 706922
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120884695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 218 (D218G)
Ref Sequence ENSEMBL: ENSMUSP00000046595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000143322] [ENSMUST00000146482]
AlphaFold O08796
Predicted Effect probably benign
Transcript: ENSMUST00000047875
AA Change: D218G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: D218G

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
AA Change: D218G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: D218G

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
AA Change: D218G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: D218G

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143322
SMART Domains Protein: ENSMUSP00000115486
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 6e-15 BLAST
Blast:Alpha_kinase 120 160 1e-21 BLAST
SCOP:d1ia9a_ 129 160 3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146482
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 37,050,840 D1485N Het
Ankrd55 T G 13: 112,323,143 D90E probably damaging Het
Arid1b C A 17: 4,995,309 P124Q unknown Het
Atxn2 C T 5: 121,785,362 P698L probably damaging Het
B020004J07Rik C T 4: 101,837,947 V56M probably damaging Het
Bend7 T C 2: 4,752,720 V191A probably benign Het
C2cd4a T G 9: 67,831,497 H88P probably damaging Het
Cacna1s C T 1: 136,092,714 Q830* probably null Het
Camta1 T C 4: 151,144,017 E786G possibly damaging Het
Caprin1 A G 2: 103,773,045 S443P probably benign Het
Cass4 T G 2: 172,427,886 F629L probably benign Het
Ccdc149 T A 5: 52,405,057 D209V probably damaging Het
Ccdc150 T C 1: 54,277,751 V263A probably damaging Het
Cfc1 C T 1: 34,537,372 R145C probably damaging Het
Cnn1 C A 9: 22,108,054 D239E probably damaging Het
Cobll1 C T 2: 65,103,172 S493N probably benign Het
Cox20 A T 1: 178,319,206 K13* probably null Het
Dclk1 G A 3: 55,463,079 S340N probably damaging Het
Dennd2c T A 3: 103,131,561 D8E probably benign Het
Dnajc10 A T 2: 80,344,983 K571N probably benign Het
Dock7 T A 4: 99,008,043 I58F Het
Dpy19l4 A G 4: 11,304,298 probably null Het
Eya4 G T 10: 23,113,946 T504K probably damaging Het
Fam222a T C 5: 114,611,337 I198T probably damaging Het
Fbxw10 T A 11: 62,857,759 F404Y probably benign Het
Fbxw24 A T 9: 109,623,613 Y105N probably damaging Het
Fzd10 T G 5: 128,601,252 L12R possibly damaging Het
Gm14443 A G 2: 175,175,817 probably benign Het
Gm21028 A T 7: 42,578,480 C37S probably damaging Het
Gpr179 G T 11: 97,338,725 A868E probably damaging Het
Greb1l T A 18: 10,532,796 Y897N possibly damaging Het
Grid1 A T 14: 35,323,403 Y401F probably benign Het
Heatr5a G A 12: 51,899,285 T1181I probably benign Het
Herc4 G A 10: 63,308,346 V753I probably damaging Het
Htra1 A T 7: 130,962,121 K241* probably null Het
Kat6b A G 14: 21,670,025 I1482V probably benign Het
Kif19a G T 11: 114,789,207 R790L possibly damaging Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Lpcat1 T C 13: 73,511,343 L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 R94W probably damaging Het
Map4 A G 9: 110,035,155 T483A probably benign Het
Mettl3 C A 14: 52,296,668 C483F probably damaging Het
Myh13 A G 11: 67,363,283 D1543G possibly damaging Het
Myh2 G A 11: 67,179,383 V414I probably damaging Het
Myh7b C T 2: 155,628,802 R1057C probably damaging Het
Myo9b A G 8: 71,359,602 S2006G probably benign Het
Nelfcd A G 2: 174,423,185 K239R probably benign Het
Nlrp4a T C 7: 26,459,652 S786P probably damaging Het
Olfr1000 T A 2: 85,607,987 K308* probably null Het
Olfr775 A G 10: 129,251,103 T190A probably damaging Het
Pdzrn4 G T 15: 92,397,335 V141L probably benign Het
Phip G T 9: 82,875,359 R1587S probably damaging Het
Plce1 A G 19: 38,737,933 E1448G probably damaging Het
Plrg1 T C 3: 83,069,001 S326P possibly damaging Het
Pom121l2 T A 13: 21,981,682 V41E probably damaging Het
Preb G T 5: 30,956,329 S311* probably null Het
Prss33 T A 17: 23,834,749 D118V probably damaging Het
Pum1 C A 4: 130,771,898 Y1008* probably null Het
Rassf2 G A 2: 132,004,406 R144C probably damaging Het
Rnf123 A T 9: 108,067,505 M429K probably benign Het
Rtl1 T A 12: 109,590,857 H1516L probably benign Het
Scyl3 T A 1: 163,936,438 N124K probably damaging Het
Sec24b A G 3: 130,007,571 S488P probably benign Het
Shc4 T A 2: 125,678,698 D277V probably damaging Het
Sorl1 T A 9: 42,001,518 D1389V probably damaging Het
Srcap T A 7: 127,559,640 I2896N unknown Het
Steap3 T A 1: 120,227,834 Y465F probably benign Het
Tecta C A 9: 42,372,897 C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem178b G A 6: 40,004,247 W72* probably null Het
Tmem235 T G 11: 117,860,839 Y30D probably damaging Het
Tpst1 C A 5: 130,134,460 T366K probably benign Het
Trdv2-1 C A 14: 53,946,391 P27T probably benign Het
Trim37 G T 11: 87,167,502 L335F possibly damaging Het
Usp9y G A Y: 1,341,873 R1331W probably damaging Het
Vmn1r1 T G 1: 182,157,437 H221P probably damaging Het
Vmn2r6 A T 3: 64,547,250 S543T probably benign Het
Wdpcp C T 11: 21,711,522 P265S probably benign Het
Wdr64 T C 1: 175,772,305 L566P possibly damaging Het
Zfp248 A G 6: 118,428,930 I566T possibly damaging Het
Zfp595 T A 13: 67,317,399 I270F probably damaging Het
Zfp715 A G 7: 43,299,423 L371P probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9044:Eef2k UTSW 7 120880361 missense probably damaging 1.00
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9445:Eef2k UTSW 7 120858471 missense probably benign
R9605:Eef2k UTSW 7 120891947 missense probably damaging 1.00
R9777:Eef2k UTSW 7 120900230 critical splice acceptor site probably benign
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGCACTGACCATGGTTCC -3'
(R):5'- CTTTGAGGATGTGAGGCTCCAC -3'

Sequencing Primer
(F):5'- TGTGGTCACATGGTCACACCTAG -3'
(R):5'- ATGTGAGGCTCCACCCACAG -3'
Posted On 2022-04-18