Incidental Mutation 'R9332:Myo9b'
ID 706927
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71272714-71360713 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71359602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 2006 (S2006G)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071935
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168839
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170242
AA Change: S2006G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: S2006G

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212412
Predicted Effect probably benign
Transcript: ENSMUST00000212935
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 37,050,840 D1485N Het
Ankrd55 T G 13: 112,323,143 D90E probably damaging Het
Arid1b C A 17: 4,995,309 P124Q unknown Het
Atxn2 C T 5: 121,785,362 P698L probably damaging Het
B020004J07Rik C T 4: 101,837,947 V56M probably damaging Het
Bend7 T C 2: 4,752,720 V191A probably benign Het
C2cd4a T G 9: 67,831,497 H88P probably damaging Het
Cacna1s C T 1: 136,092,714 Q830* probably null Het
Camta1 T C 4: 151,144,017 E786G possibly damaging Het
Caprin1 A G 2: 103,773,045 S443P probably benign Het
Cass4 T G 2: 172,427,886 F629L probably benign Het
Ccdc149 T A 5: 52,405,057 D209V probably damaging Het
Ccdc150 T C 1: 54,277,751 V263A probably damaging Het
Cfc1 C T 1: 34,537,372 R145C probably damaging Het
Cnn1 C A 9: 22,108,054 D239E probably damaging Het
Cobll1 C T 2: 65,103,172 S493N probably benign Het
Cox20 A T 1: 178,319,206 K13* probably null Het
Dclk1 G A 3: 55,463,079 S340N probably damaging Het
Dennd2c T A 3: 103,131,561 D8E probably benign Het
Dnajc10 A T 2: 80,344,983 K571N probably benign Het
Dock7 T A 4: 99,008,043 I58F Het
Dpy19l4 A G 4: 11,304,298 probably null Het
Eef2k A G 7: 120,884,695 D218G probably benign Het
Eya4 G T 10: 23,113,946 T504K probably damaging Het
Fam222a T C 5: 114,611,337 I198T probably damaging Het
Fbxw10 T A 11: 62,857,759 F404Y probably benign Het
Fbxw24 A T 9: 109,623,613 Y105N probably damaging Het
Fzd10 T G 5: 128,601,252 L12R possibly damaging Het
Gm14443 A G 2: 175,175,817 probably benign Het
Gm21028 A T 7: 42,578,480 C37S probably damaging Het
Gpr179 G T 11: 97,338,725 A868E probably damaging Het
Greb1l T A 18: 10,532,796 Y897N possibly damaging Het
Grid1 A T 14: 35,323,403 Y401F probably benign Het
Heatr5a G A 12: 51,899,285 T1181I probably benign Het
Herc4 G A 10: 63,308,346 V753I probably damaging Het
Htra1 A T 7: 130,962,121 K241* probably null Het
Kat6b A G 14: 21,670,025 I1482V probably benign Het
Kif19a G T 11: 114,789,207 R790L possibly damaging Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Lpcat1 T C 13: 73,511,343 L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 R94W probably damaging Het
Map4 A G 9: 110,035,155 T483A probably benign Het
Mettl3 C A 14: 52,296,668 C483F probably damaging Het
Myh13 A G 11: 67,363,283 D1543G possibly damaging Het
Myh2 G A 11: 67,179,383 V414I probably damaging Het
Myh7b C T 2: 155,628,802 R1057C probably damaging Het
Nelfcd A G 2: 174,423,185 K239R probably benign Het
Nlrp4a T C 7: 26,459,652 S786P probably damaging Het
Olfr1000 T A 2: 85,607,987 K308* probably null Het
Olfr775 A G 10: 129,251,103 T190A probably damaging Het
Pdzrn4 G T 15: 92,397,335 V141L probably benign Het
Phip G T 9: 82,875,359 R1587S probably damaging Het
Plce1 A G 19: 38,737,933 E1448G probably damaging Het
Plrg1 T C 3: 83,069,001 S326P possibly damaging Het
Pom121l2 T A 13: 21,981,682 V41E probably damaging Het
Preb G T 5: 30,956,329 S311* probably null Het
Prss33 T A 17: 23,834,749 D118V probably damaging Het
Pum1 C A 4: 130,771,898 Y1008* probably null Het
Rassf2 G A 2: 132,004,406 R144C probably damaging Het
Rnf123 A T 9: 108,067,505 M429K probably benign Het
Rtl1 T A 12: 109,590,857 H1516L probably benign Het
Scyl3 T A 1: 163,936,438 N124K probably damaging Het
Sec24b A G 3: 130,007,571 S488P probably benign Het
Shc4 T A 2: 125,678,698 D277V probably damaging Het
Sorl1 T A 9: 42,001,518 D1389V probably damaging Het
Srcap T A 7: 127,559,640 I2896N unknown Het
Steap3 T A 1: 120,227,834 Y465F probably benign Het
Tecta C A 9: 42,372,897 C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem178b G A 6: 40,004,247 W72* probably null Het
Tmem235 T G 11: 117,860,839 Y30D probably damaging Het
Tpst1 C A 5: 130,134,460 T366K probably benign Het
Trdv2-1 C A 14: 53,946,391 P27T probably benign Het
Trim37 G T 11: 87,167,502 L335F possibly damaging Het
Usp9y G A Y: 1,341,873 R1331W probably damaging Het
Vmn1r1 T G 1: 182,157,437 H221P probably damaging Het
Vmn2r6 A T 3: 64,547,250 S543T probably benign Het
Wdpcp C T 11: 21,711,522 P265S probably benign Het
Wdr64 T C 1: 175,772,305 L566P possibly damaging Het
Zfp248 A G 6: 118,428,930 I566T possibly damaging Het
Zfp595 T A 13: 67,317,399 I270F probably damaging Het
Zfp715 A G 7: 43,299,423 L371P probably damaging Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0689:Myo9b UTSW 8 71330756 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2037:Myo9b UTSW 8 71290866 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2920:Myo9b UTSW 8 71325857 missense probably damaging 0.98
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R4736:Myo9b UTSW 8 71356592 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
R7957:Myo9b UTSW 8 71354761 missense probably benign 0.12
R8062:Myo9b UTSW 8 71321813 missense probably damaging 0.99
R8108:Myo9b UTSW 8 71348342 missense probably damaging 0.99
R8197:Myo9b UTSW 8 71290963 missense probably damaging 1.00
R8274:Myo9b UTSW 8 71359836 missense probably benign 0.00
R8686:Myo9b UTSW 8 71334322 missense probably benign 0.01
R8731:Myo9b UTSW 8 71353842 critical splice donor site probably null
R8924:Myo9b UTSW 8 71349031 missense probably benign
R9056:Myo9b UTSW 8 71352262 missense probably benign 0.17
R9117:Myo9b UTSW 8 71347807 missense probably benign 0.03
R9315:Myo9b UTSW 8 71349167 missense possibly damaging 0.54
R9364:Myo9b UTSW 8 71355839 missense probably damaging 1.00
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71290709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCTTGACTCAGAGACATC -3'
(R):5'- ACTGGAACAACAGCCTCCTG -3'

Sequencing Primer
(F):5'- TTGACTCAGAGACATCGGCCAG -3'
(R):5'- AACAGCCTCCTGGAGAGCAG -3'
Posted On 2022-04-18