Incidental Mutation 'R9332:Myo9b'
ID 706927
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71725358-71813357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71812246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 2006 (S2006G)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071935
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168839
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170242
AA Change: S2006G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: S2006G

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212412
Predicted Effect probably benign
Transcript: ENSMUST00000212935
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T G 13: 112,459,677 (GRCm39) D90E probably damaging Het
Arid1b C A 17: 5,045,584 (GRCm39) P124Q unknown Het
Atxn2 C T 5: 121,923,425 (GRCm39) P698L probably damaging Het
Bend7 T C 2: 4,757,531 (GRCm39) V191A probably benign Het
Bltp1 G A 3: 37,104,989 (GRCm39) D1485N Het
C2cd4a T G 9: 67,738,779 (GRCm39) H88P probably damaging Het
Cacna1s C T 1: 136,020,452 (GRCm39) Q830* probably null Het
Camta1 T C 4: 151,228,474 (GRCm39) E786G possibly damaging Het
Caprin1 A G 2: 103,603,390 (GRCm39) S443P probably benign Het
Cass4 T G 2: 172,269,806 (GRCm39) F629L probably benign Het
Ccdc149 T A 5: 52,562,399 (GRCm39) D209V probably damaging Het
Ccdc150 T C 1: 54,316,910 (GRCm39) V263A probably damaging Het
Cfc1 C T 1: 34,576,453 (GRCm39) R145C probably damaging Het
Cnn1 C A 9: 22,019,350 (GRCm39) D239E probably damaging Het
Cobll1 C T 2: 64,933,516 (GRCm39) S493N probably benign Het
Cox20 A T 1: 178,146,771 (GRCm39) K13* probably null Het
Dclk1 G A 3: 55,370,500 (GRCm39) S340N probably damaging Het
Dennd2c T A 3: 103,038,877 (GRCm39) D8E probably benign Het
Dnajc10 A T 2: 80,175,327 (GRCm39) K571N probably benign Het
Dock7 T A 4: 98,896,280 (GRCm39) I58F Het
Dpy19l4 A G 4: 11,304,298 (GRCm39) probably null Het
Eef2k A G 7: 120,483,918 (GRCm39) D218G probably benign Het
Eya4 G T 10: 22,989,845 (GRCm39) T504K probably damaging Het
Fam222a T C 5: 114,749,398 (GRCm39) I198T probably damaging Het
Fbxw10 T A 11: 62,748,585 (GRCm39) F404Y probably benign Het
Fbxw24 A T 9: 109,452,681 (GRCm39) Y105N probably damaging Het
Fzd10 T G 5: 128,678,316 (GRCm39) L12R possibly damaging Het
Gm14443 A G 2: 175,017,610 (GRCm39) probably benign Het
Gm21028 A T 7: 42,227,904 (GRCm39) C37S probably damaging Het
Gpr179 G T 11: 97,229,551 (GRCm39) A868E probably damaging Het
Greb1l T A 18: 10,532,796 (GRCm39) Y897N possibly damaging Het
Grid1 A T 14: 35,045,360 (GRCm39) Y401F probably benign Het
Heatr5a G A 12: 51,946,068 (GRCm39) T1181I probably benign Het
Herc4 G A 10: 63,144,125 (GRCm39) V753I probably damaging Het
Htra1 A T 7: 130,563,851 (GRCm39) K241* probably null Het
Kat6b A G 14: 21,720,093 (GRCm39) I1482V probably benign Het
Kif19a G T 11: 114,680,033 (GRCm39) R790L possibly damaging Het
Lmf2 G A 15: 89,239,577 (GRCm39) L26F probably damaging Het
Lpcat1 T C 13: 73,659,462 (GRCm39) L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 (GRCm39) R94W probably damaging Het
Map4 A G 9: 109,864,223 (GRCm39) T483A probably benign Het
Mettl3 C A 14: 52,534,125 (GRCm39) C483F probably damaging Het
Myh13 A G 11: 67,254,109 (GRCm39) D1543G possibly damaging Het
Myh2 G A 11: 67,070,209 (GRCm39) V414I probably damaging Het
Myh7b C T 2: 155,470,722 (GRCm39) R1057C probably damaging Het
Nelfcd A G 2: 174,264,978 (GRCm39) K239R probably benign Het
Nlrp4a T C 7: 26,159,077 (GRCm39) S786P probably damaging Het
Or5g23 T A 2: 85,438,331 (GRCm39) K308* probably null Het
Or6c205 A G 10: 129,086,972 (GRCm39) T190A probably damaging Het
Pdzrn4 G T 15: 92,295,216 (GRCm39) V141L probably benign Het
Phip G T 9: 82,757,412 (GRCm39) R1587S probably damaging Het
Plce1 A G 19: 38,726,377 (GRCm39) E1448G probably damaging Het
Plrg1 T C 3: 82,976,308 (GRCm39) S326P possibly damaging Het
Pom121l2 T A 13: 22,165,852 (GRCm39) V41E probably damaging Het
Pramel17 C T 4: 101,695,144 (GRCm39) V56M probably damaging Het
Preb G T 5: 31,113,673 (GRCm39) S311* probably null Het
Prss33 T A 17: 24,053,723 (GRCm39) D118V probably damaging Het
Pum1 C A 4: 130,499,209 (GRCm39) Y1008* probably null Het
Rassf2 G A 2: 131,846,326 (GRCm39) R144C probably damaging Het
Rnf123 A T 9: 107,944,704 (GRCm39) M429K probably benign Het
Rtl1 T A 12: 109,557,291 (GRCm39) H1516L probably benign Het
Scyl3 T A 1: 163,764,007 (GRCm39) N124K probably damaging Het
Sec24b A G 3: 129,801,220 (GRCm39) S488P probably benign Het
Shc4 T A 2: 125,520,618 (GRCm39) D277V probably damaging Het
Sorl1 T A 9: 41,912,814 (GRCm39) D1389V probably damaging Het
Srcap T A 7: 127,158,812 (GRCm39) I2896N unknown Het
Steap3 T A 1: 120,155,564 (GRCm39) Y465F probably benign Het
Tecta C A 9: 42,284,193 (GRCm39) C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,650,882 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem178b G A 6: 39,981,181 (GRCm39) W72* probably null Het
Tmem235 T G 11: 117,751,665 (GRCm39) Y30D probably damaging Het
Tpst1 C A 5: 130,163,301 (GRCm39) T366K probably benign Het
Trdv2-1 C A 14: 54,183,848 (GRCm39) P27T probably benign Het
Trim37 G T 11: 87,058,328 (GRCm39) L335F possibly damaging Het
Usp9y G A Y: 1,341,873 (GRCm39) R1331W probably damaging Het
Vmn1r1 T G 1: 181,985,002 (GRCm39) H221P probably damaging Het
Vmn2r6 A T 3: 64,454,671 (GRCm39) S543T probably benign Het
Wdpcp C T 11: 21,661,522 (GRCm39) P265S probably benign Het
Wdr64 T C 1: 175,599,871 (GRCm39) L566P possibly damaging Het
Zfp248 A G 6: 118,405,891 (GRCm39) I566T possibly damaging Het
Zfp595 T A 13: 67,465,463 (GRCm39) I270F probably damaging Het
Zfp715 A G 7: 42,948,847 (GRCm39) L371P probably damaging Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71,801,379 (GRCm39) missense probably benign
IGL01020:Myo9b APN 8 71,804,644 (GRCm39) missense probably benign
IGL01479:Myo9b APN 8 71,811,986 (GRCm39) missense probably damaging 1.00
IGL01704:Myo9b APN 8 71,812,286 (GRCm39) missense probably damaging 0.98
IGL01761:Myo9b APN 8 71,801,796 (GRCm39) missense probably damaging 0.96
IGL01766:Myo9b APN 8 71,743,161 (GRCm39) missense probably damaging 1.00
IGL01834:Myo9b APN 8 71,807,901 (GRCm39) missense possibly damaging 0.93
IGL01834:Myo9b APN 8 71,808,962 (GRCm39) missense probably damaging 1.00
IGL01838:Myo9b APN 8 71,787,034 (GRCm39) missense probably damaging 0.99
IGL02318:Myo9b APN 8 71,806,768 (GRCm39) missense probably damaging 0.98
IGL02333:Myo9b APN 8 71,811,637 (GRCm39) missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71,743,689 (GRCm39) missense probably damaging 1.00
IGL02514:Myo9b APN 8 71,743,650 (GRCm39) missense probably damaging 1.00
IGL02593:Myo9b APN 8 71,743,417 (GRCm39) missense probably damaging 1.00
IGL03075:Myo9b APN 8 71,807,171 (GRCm39) missense probably damaging 1.00
IGL03332:Myo9b APN 8 71,801,418 (GRCm39) missense possibly damaging 0.78
avantgarde UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
Freaky UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
iconoclastic UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
unconventional UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71,775,591 (GRCm39) missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71,795,456 (GRCm39) missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71,786,412 (GRCm39) missense probably damaging 1.00
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0144:Myo9b UTSW 8 71,798,687 (GRCm39) missense probably damaging 1.00
R0207:Myo9b UTSW 8 71,807,869 (GRCm39) splice site probably benign
R0226:Myo9b UTSW 8 71,806,476 (GRCm39) missense probably damaging 1.00
R0227:Myo9b UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
R0244:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 1.00
R0277:Myo9b UTSW 8 71,808,596 (GRCm39) splice site probably benign
R0362:Myo9b UTSW 8 71,800,414 (GRCm39) missense probably damaging 1.00
R0689:Myo9b UTSW 8 71,783,400 (GRCm39) missense probably damaging 1.00
R0844:Myo9b UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
R1051:Myo9b UTSW 8 71,808,466 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1526:Myo9b UTSW 8 71,808,408 (GRCm39) missense probably damaging 1.00
R1544:Myo9b UTSW 8 71,743,620 (GRCm39) missense probably damaging 1.00
R1565:Myo9b UTSW 8 71,767,836 (GRCm39) missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71,775,622 (GRCm39) missense probably damaging 1.00
R1745:Myo9b UTSW 8 71,806,691 (GRCm39) missense probably damaging 1.00
R1820:Myo9b UTSW 8 71,786,002 (GRCm39) missense probably damaging 1.00
R2037:Myo9b UTSW 8 71,743,510 (GRCm39) missense probably damaging 1.00
R2050:Myo9b UTSW 8 71,743,194 (GRCm39) missense probably damaging 1.00
R2056:Myo9b UTSW 8 71,812,334 (GRCm39) missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71,786,343 (GRCm39) missense probably damaging 1.00
R2423:Myo9b UTSW 8 71,780,584 (GRCm39) missense probably damaging 1.00
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2873:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2874:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2920:Myo9b UTSW 8 71,778,501 (GRCm39) missense probably damaging 0.98
R2926:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2939:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2940:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3033:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3040:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3689:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3691:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3735:Myo9b UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
R4194:Myo9b UTSW 8 71,812,268 (GRCm39) missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71,808,409 (GRCm39) missense probably damaging 1.00
R4457:Myo9b UTSW 8 71,743,643 (GRCm39) missense probably damaging 1.00
R4478:Myo9b UTSW 8 71,743,725 (GRCm39) missense probably damaging 1.00
R4496:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R4544:Myo9b UTSW 8 71,780,585 (GRCm39) missense probably damaging 1.00
R4580:Myo9b UTSW 8 71,767,779 (GRCm39) missense probably damaging 1.00
R4736:Myo9b UTSW 8 71,809,236 (GRCm39) missense probably damaging 1.00
R5068:Myo9b UTSW 8 71,801,699 (GRCm39) missense probably damaging 1.00
R5124:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R5194:Myo9b UTSW 8 71,801,733 (GRCm39) missense probably benign 0.01
R5296:Myo9b UTSW 8 71,786,032 (GRCm39) missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71,775,918 (GRCm39) missense probably benign 0.06
R5664:Myo9b UTSW 8 71,812,526 (GRCm39) missense probably benign 0.13
R5677:Myo9b UTSW 8 71,796,330 (GRCm39) missense probably damaging 1.00
R5680:Myo9b UTSW 8 71,743,016 (GRCm39) missense probably benign 0.00
R5982:Myo9b UTSW 8 71,801,040 (GRCm39) missense probably benign 0.05
R6344:Myo9b UTSW 8 71,780,558 (GRCm39) missense probably damaging 1.00
R6352:Myo9b UTSW 8 71,801,055 (GRCm39) missense probably benign
R6352:Myo9b UTSW 8 71,801,054 (GRCm39) missense probably benign 0.16
R6411:Myo9b UTSW 8 71,775,599 (GRCm39) nonsense probably null
R6425:Myo9b UTSW 8 71,786,272 (GRCm39) missense probably damaging 1.00
R6505:Myo9b UTSW 8 71,808,501 (GRCm39) missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71,804,803 (GRCm39) splice site probably null
R6811:Myo9b UTSW 8 71,809,222 (GRCm39) missense probably damaging 1.00
R6813:Myo9b UTSW 8 71,775,949 (GRCm39) missense probably damaging 1.00
R6954:Myo9b UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
R7124:Myo9b UTSW 8 71,786,345 (GRCm39) nonsense probably null
R7255:Myo9b UTSW 8 71,743,535 (GRCm39) missense probably damaging 1.00
R7293:Myo9b UTSW 8 71,778,549 (GRCm39) missense probably benign 0.00
R7342:Myo9b UTSW 8 71,808,418 (GRCm39) missense probably damaging 1.00
R7451:Myo9b UTSW 8 71,804,832 (GRCm39) missense probably benign 0.28
R7482:Myo9b UTSW 8 71,795,442 (GRCm39) missense probably benign 0.00
R7508:Myo9b UTSW 8 71,807,445 (GRCm39) missense probably benign 0.00
R7957:Myo9b UTSW 8 71,807,405 (GRCm39) missense probably benign 0.12
R8062:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 0.99
R8108:Myo9b UTSW 8 71,800,986 (GRCm39) missense probably damaging 0.99
R8197:Myo9b UTSW 8 71,743,607 (GRCm39) missense probably damaging 1.00
R8274:Myo9b UTSW 8 71,812,480 (GRCm39) missense probably benign 0.00
R8686:Myo9b UTSW 8 71,786,966 (GRCm39) missense probably benign 0.01
R8731:Myo9b UTSW 8 71,806,486 (GRCm39) critical splice donor site probably null
R8924:Myo9b UTSW 8 71,801,675 (GRCm39) missense probably benign
R9056:Myo9b UTSW 8 71,804,906 (GRCm39) missense probably benign 0.17
R9117:Myo9b UTSW 8 71,800,451 (GRCm39) missense probably benign 0.03
R9151:Myo9b UTSW 8 71,807,871 (GRCm39) splice site probably benign
R9315:Myo9b UTSW 8 71,801,811 (GRCm39) missense possibly damaging 0.54
R9364:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R9569:Myo9b UTSW 8 71,811,629 (GRCm39) missense probably benign
R9581:Myo9b UTSW 8 71,812,543 (GRCm39) missense probably benign 0.19
R9600:Myo9b UTSW 8 71,743,075 (GRCm39) missense possibly damaging 0.80
X0066:Myo9b UTSW 8 71,776,542 (GRCm39) missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71,743,353 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCTTGACTCAGAGACATC -3'
(R):5'- ACTGGAACAACAGCCTCCTG -3'

Sequencing Primer
(F):5'- TTGACTCAGAGACATCGGCCAG -3'
(R):5'- AACAGCCTCCTGGAGAGCAG -3'
Posted On 2022-04-18