Incidental Mutation 'R9332:Rnf123'
ID 706933
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108067505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 429 (M429K)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 37,050,840 D1485N Het
Ankrd55 T G 13: 112,323,143 D90E probably damaging Het
Arid1b C A 17: 4,995,309 P124Q unknown Het
Atxn2 C T 5: 121,785,362 P698L probably damaging Het
B020004J07Rik C T 4: 101,837,947 V56M probably damaging Het
Bend7 T C 2: 4,752,720 V191A probably benign Het
C2cd4a T G 9: 67,831,497 H88P probably damaging Het
Cacna1s C T 1: 136,092,714 Q830* probably null Het
Camta1 T C 4: 151,144,017 E786G possibly damaging Het
Caprin1 A G 2: 103,773,045 S443P probably benign Het
Cass4 T G 2: 172,427,886 F629L probably benign Het
Ccdc149 T A 5: 52,405,057 D209V probably damaging Het
Ccdc150 T C 1: 54,277,751 V263A probably damaging Het
Cfc1 C T 1: 34,537,372 R145C probably damaging Het
Cnn1 C A 9: 22,108,054 D239E probably damaging Het
Cobll1 C T 2: 65,103,172 S493N probably benign Het
Cox20 A T 1: 178,319,206 K13* probably null Het
Dclk1 G A 3: 55,463,079 S340N probably damaging Het
Dennd2c T A 3: 103,131,561 D8E probably benign Het
Dnajc10 A T 2: 80,344,983 K571N probably benign Het
Dock7 T A 4: 99,008,043 I58F Het
Dpy19l4 A G 4: 11,304,298 probably null Het
Eef2k A G 7: 120,884,695 D218G probably benign Het
Eya4 G T 10: 23,113,946 T504K probably damaging Het
Fam222a T C 5: 114,611,337 I198T probably damaging Het
Fbxw10 T A 11: 62,857,759 F404Y probably benign Het
Fbxw24 A T 9: 109,623,613 Y105N probably damaging Het
Fzd10 T G 5: 128,601,252 L12R possibly damaging Het
Gm14443 A G 2: 175,175,817 probably benign Het
Gm21028 A T 7: 42,578,480 C37S probably damaging Het
Gpr179 G T 11: 97,338,725 A868E probably damaging Het
Greb1l T A 18: 10,532,796 Y897N possibly damaging Het
Grid1 A T 14: 35,323,403 Y401F probably benign Het
Heatr5a G A 12: 51,899,285 T1181I probably benign Het
Herc4 G A 10: 63,308,346 V753I probably damaging Het
Htra1 A T 7: 130,962,121 K241* probably null Het
Kat6b A G 14: 21,670,025 I1482V probably benign Het
Kif19a G T 11: 114,789,207 R790L possibly damaging Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Lpcat1 T C 13: 73,511,343 L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 R94W probably damaging Het
Map4 A G 9: 110,035,155 T483A probably benign Het
Mettl3 C A 14: 52,296,668 C483F probably damaging Het
Myh13 A G 11: 67,363,283 D1543G possibly damaging Het
Myh2 G A 11: 67,179,383 V414I probably damaging Het
Myh7b C T 2: 155,628,802 R1057C probably damaging Het
Myo9b A G 8: 71,359,602 S2006G probably benign Het
Nelfcd A G 2: 174,423,185 K239R probably benign Het
Nlrp4a T C 7: 26,459,652 S786P probably damaging Het
Olfr1000 T A 2: 85,607,987 K308* probably null Het
Olfr775 A G 10: 129,251,103 T190A probably damaging Het
Pdzrn4 G T 15: 92,397,335 V141L probably benign Het
Phip G T 9: 82,875,359 R1587S probably damaging Het
Plce1 A G 19: 38,737,933 E1448G probably damaging Het
Plrg1 T C 3: 83,069,001 S326P possibly damaging Het
Pom121l2 T A 13: 21,981,682 V41E probably damaging Het
Preb G T 5: 30,956,329 S311* probably null Het
Prss33 T A 17: 23,834,749 D118V probably damaging Het
Pum1 C A 4: 130,771,898 Y1008* probably null Het
Rassf2 G A 2: 132,004,406 R144C probably damaging Het
Rtl1 T A 12: 109,590,857 H1516L probably benign Het
Scyl3 T A 1: 163,936,438 N124K probably damaging Het
Sec24b A G 3: 130,007,571 S488P probably benign Het
Shc4 T A 2: 125,678,698 D277V probably damaging Het
Sorl1 T A 9: 42,001,518 D1389V probably damaging Het
Srcap T A 7: 127,559,640 I2896N unknown Het
Steap3 T A 1: 120,227,834 Y465F probably benign Het
Tecta C A 9: 42,372,897 C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem178b G A 6: 40,004,247 W72* probably null Het
Tmem235 T G 11: 117,860,839 Y30D probably damaging Het
Tpst1 C A 5: 130,134,460 T366K probably benign Het
Trdv2-1 C A 14: 53,946,391 P27T probably benign Het
Trim37 G T 11: 87,167,502 L335F possibly damaging Het
Usp9y G A Y: 1,341,873 R1331W probably damaging Het
Vmn1r1 T G 1: 182,157,437 H221P probably damaging Het
Vmn2r6 A T 3: 64,547,250 S543T probably benign Het
Wdpcp C T 11: 21,711,522 P265S probably benign Het
Wdr64 T C 1: 175,772,305 L566P possibly damaging Het
Zfp248 A G 6: 118,428,930 I566T possibly damaging Het
Zfp595 T A 13: 67,317,399 I270F probably damaging Het
Zfp715 A G 7: 43,299,423 L371P probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACCCCAAGGACTTCGG -3'
(R):5'- CTGACCTAGGACCATCGGTTAC -3'

Sequencing Primer
(F):5'- CAGAAGAGACCCCAGGTGC -3'
(R):5'- TAGGACCATCGGTTACCCCTG -3'
Posted On 2022-04-18