Incidental Mutation 'R9332:Rnf123'
ID 706933
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107944704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 429 (M429K)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: M429K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: M429K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 T G 13: 112,459,677 (GRCm39) D90E probably damaging Het
Arid1b C A 17: 5,045,584 (GRCm39) P124Q unknown Het
Atxn2 C T 5: 121,923,425 (GRCm39) P698L probably damaging Het
Bend7 T C 2: 4,757,531 (GRCm39) V191A probably benign Het
Bltp1 G A 3: 37,104,989 (GRCm39) D1485N Het
C2cd4a T G 9: 67,738,779 (GRCm39) H88P probably damaging Het
Cacna1s C T 1: 136,020,452 (GRCm39) Q830* probably null Het
Camta1 T C 4: 151,228,474 (GRCm39) E786G possibly damaging Het
Caprin1 A G 2: 103,603,390 (GRCm39) S443P probably benign Het
Cass4 T G 2: 172,269,806 (GRCm39) F629L probably benign Het
Ccdc149 T A 5: 52,562,399 (GRCm39) D209V probably damaging Het
Ccdc150 T C 1: 54,316,910 (GRCm39) V263A probably damaging Het
Cfc1 C T 1: 34,576,453 (GRCm39) R145C probably damaging Het
Cnn1 C A 9: 22,019,350 (GRCm39) D239E probably damaging Het
Cobll1 C T 2: 64,933,516 (GRCm39) S493N probably benign Het
Cox20 A T 1: 178,146,771 (GRCm39) K13* probably null Het
Dclk1 G A 3: 55,370,500 (GRCm39) S340N probably damaging Het
Dennd2c T A 3: 103,038,877 (GRCm39) D8E probably benign Het
Dnajc10 A T 2: 80,175,327 (GRCm39) K571N probably benign Het
Dock7 T A 4: 98,896,280 (GRCm39) I58F Het
Dpy19l4 A G 4: 11,304,298 (GRCm39) probably null Het
Eef2k A G 7: 120,483,918 (GRCm39) D218G probably benign Het
Eya4 G T 10: 22,989,845 (GRCm39) T504K probably damaging Het
Fam222a T C 5: 114,749,398 (GRCm39) I198T probably damaging Het
Fbxw10 T A 11: 62,748,585 (GRCm39) F404Y probably benign Het
Fbxw24 A T 9: 109,452,681 (GRCm39) Y105N probably damaging Het
Fzd10 T G 5: 128,678,316 (GRCm39) L12R possibly damaging Het
Gm14443 A G 2: 175,017,610 (GRCm39) probably benign Het
Gm21028 A T 7: 42,227,904 (GRCm39) C37S probably damaging Het
Gpr179 G T 11: 97,229,551 (GRCm39) A868E probably damaging Het
Greb1l T A 18: 10,532,796 (GRCm39) Y897N possibly damaging Het
Grid1 A T 14: 35,045,360 (GRCm39) Y401F probably benign Het
Heatr5a G A 12: 51,946,068 (GRCm39) T1181I probably benign Het
Herc4 G A 10: 63,144,125 (GRCm39) V753I probably damaging Het
Htra1 A T 7: 130,563,851 (GRCm39) K241* probably null Het
Kat6b A G 14: 21,720,093 (GRCm39) I1482V probably benign Het
Kif19a G T 11: 114,680,033 (GRCm39) R790L possibly damaging Het
Lmf2 G A 15: 89,239,577 (GRCm39) L26F probably damaging Het
Lpcat1 T C 13: 73,659,462 (GRCm39) L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 (GRCm39) R94W probably damaging Het
Map4 A G 9: 109,864,223 (GRCm39) T483A probably benign Het
Mettl3 C A 14: 52,534,125 (GRCm39) C483F probably damaging Het
Myh13 A G 11: 67,254,109 (GRCm39) D1543G possibly damaging Het
Myh2 G A 11: 67,070,209 (GRCm39) V414I probably damaging Het
Myh7b C T 2: 155,470,722 (GRCm39) R1057C probably damaging Het
Myo9b A G 8: 71,812,246 (GRCm39) S2006G probably benign Het
Nelfcd A G 2: 174,264,978 (GRCm39) K239R probably benign Het
Nlrp4a T C 7: 26,159,077 (GRCm39) S786P probably damaging Het
Or5g23 T A 2: 85,438,331 (GRCm39) K308* probably null Het
Or6c205 A G 10: 129,086,972 (GRCm39) T190A probably damaging Het
Pdzrn4 G T 15: 92,295,216 (GRCm39) V141L probably benign Het
Phip G T 9: 82,757,412 (GRCm39) R1587S probably damaging Het
Plce1 A G 19: 38,726,377 (GRCm39) E1448G probably damaging Het
Plrg1 T C 3: 82,976,308 (GRCm39) S326P possibly damaging Het
Pom121l2 T A 13: 22,165,852 (GRCm39) V41E probably damaging Het
Pramel17 C T 4: 101,695,144 (GRCm39) V56M probably damaging Het
Preb G T 5: 31,113,673 (GRCm39) S311* probably null Het
Prss33 T A 17: 24,053,723 (GRCm39) D118V probably damaging Het
Pum1 C A 4: 130,499,209 (GRCm39) Y1008* probably null Het
Rassf2 G A 2: 131,846,326 (GRCm39) R144C probably damaging Het
Rtl1 T A 12: 109,557,291 (GRCm39) H1516L probably benign Het
Scyl3 T A 1: 163,764,007 (GRCm39) N124K probably damaging Het
Sec24b A G 3: 129,801,220 (GRCm39) S488P probably benign Het
Shc4 T A 2: 125,520,618 (GRCm39) D277V probably damaging Het
Sorl1 T A 9: 41,912,814 (GRCm39) D1389V probably damaging Het
Srcap T A 7: 127,158,812 (GRCm39) I2896N unknown Het
Steap3 T A 1: 120,155,564 (GRCm39) Y465F probably benign Het
Tecta C A 9: 42,284,193 (GRCm39) C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,650,882 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmem178b G A 6: 39,981,181 (GRCm39) W72* probably null Het
Tmem235 T G 11: 117,751,665 (GRCm39) Y30D probably damaging Het
Tpst1 C A 5: 130,163,301 (GRCm39) T366K probably benign Het
Trdv2-1 C A 14: 54,183,848 (GRCm39) P27T probably benign Het
Trim37 G T 11: 87,058,328 (GRCm39) L335F possibly damaging Het
Usp9y G A Y: 1,341,873 (GRCm39) R1331W probably damaging Het
Vmn1r1 T G 1: 181,985,002 (GRCm39) H221P probably damaging Het
Vmn2r6 A T 3: 64,454,671 (GRCm39) S543T probably benign Het
Wdpcp C T 11: 21,661,522 (GRCm39) P265S probably benign Het
Wdr64 T C 1: 175,599,871 (GRCm39) L566P possibly damaging Het
Zfp248 A G 6: 118,405,891 (GRCm39) I566T possibly damaging Het
Zfp595 T A 13: 67,465,463 (GRCm39) I270F probably damaging Het
Zfp715 A G 7: 42,948,847 (GRCm39) L371P probably damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACCCCAAGGACTTCGG -3'
(R):5'- CTGACCTAGGACCATCGGTTAC -3'

Sequencing Primer
(F):5'- CAGAAGAGACCCCAGGTGC -3'
(R):5'- TAGGACCATCGGTTACCCCTG -3'
Posted On 2022-04-18