Incidental Mutation 'R9332:Myh13'
ID 706942
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Name myosin, heavy polypeptide 13, skeletal muscle
Synonyms EO Myosin, extraocular myosin, MyHC-eo
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9332 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67321658-67371586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67363283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1543 (D1543G)
Ref Sequence ENSEMBL: ENSMUSP00000080584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
AlphaFold B1AR69
Predicted Effect possibly damaging
Transcript: ENSMUST00000081911
AA Change: D1543G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: D1543G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108684
AA Change: D1543G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: D1543G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180845
AA Change: D1543G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: D1543G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181027
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 37,050,840 D1485N Het
Ankrd55 T G 13: 112,323,143 D90E probably damaging Het
Arid1b C A 17: 4,995,309 P124Q unknown Het
Atxn2 C T 5: 121,785,362 P698L probably damaging Het
B020004J07Rik C T 4: 101,837,947 V56M probably damaging Het
Bend7 T C 2: 4,752,720 V191A probably benign Het
C2cd4a T G 9: 67,831,497 H88P probably damaging Het
Cacna1s C T 1: 136,092,714 Q830* probably null Het
Camta1 T C 4: 151,144,017 E786G possibly damaging Het
Caprin1 A G 2: 103,773,045 S443P probably benign Het
Cass4 T G 2: 172,427,886 F629L probably benign Het
Ccdc149 T A 5: 52,405,057 D209V probably damaging Het
Ccdc150 T C 1: 54,277,751 V263A probably damaging Het
Cfc1 C T 1: 34,537,372 R145C probably damaging Het
Cnn1 C A 9: 22,108,054 D239E probably damaging Het
Cobll1 C T 2: 65,103,172 S493N probably benign Het
Cox20 A T 1: 178,319,206 K13* probably null Het
Dclk1 G A 3: 55,463,079 S340N probably damaging Het
Dennd2c T A 3: 103,131,561 D8E probably benign Het
Dnajc10 A T 2: 80,344,983 K571N probably benign Het
Dock7 T A 4: 99,008,043 I58F Het
Dpy19l4 A G 4: 11,304,298 probably null Het
Eef2k A G 7: 120,884,695 D218G probably benign Het
Eya4 G T 10: 23,113,946 T504K probably damaging Het
Fam222a T C 5: 114,611,337 I198T probably damaging Het
Fbxw10 T A 11: 62,857,759 F404Y probably benign Het
Fbxw24 A T 9: 109,623,613 Y105N probably damaging Het
Fzd10 T G 5: 128,601,252 L12R possibly damaging Het
Gm14443 A G 2: 175,175,817 probably benign Het
Gm21028 A T 7: 42,578,480 C37S probably damaging Het
Gpr179 G T 11: 97,338,725 A868E probably damaging Het
Greb1l T A 18: 10,532,796 Y897N possibly damaging Het
Grid1 A T 14: 35,323,403 Y401F probably benign Het
Heatr5a G A 12: 51,899,285 T1181I probably benign Het
Herc4 G A 10: 63,308,346 V753I probably damaging Het
Htra1 A T 7: 130,962,121 K241* probably null Het
Kat6b A G 14: 21,670,025 I1482V probably benign Het
Kif19a G T 11: 114,789,207 R790L possibly damaging Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Lpcat1 T C 13: 73,511,343 L408S probably damaging Het
Lrrc69 T A 4: 14,774,987 R94W probably damaging Het
Map4 A G 9: 110,035,155 T483A probably benign Het
Mettl3 C A 14: 52,296,668 C483F probably damaging Het
Myh2 G A 11: 67,179,383 V414I probably damaging Het
Myh7b C T 2: 155,628,802 R1057C probably damaging Het
Myo9b A G 8: 71,359,602 S2006G probably benign Het
Nelfcd A G 2: 174,423,185 K239R probably benign Het
Nlrp4a T C 7: 26,459,652 S786P probably damaging Het
Olfr1000 T A 2: 85,607,987 K308* probably null Het
Olfr775 A G 10: 129,251,103 T190A probably damaging Het
Pdzrn4 G T 15: 92,397,335 V141L probably benign Het
Phip G T 9: 82,875,359 R1587S probably damaging Het
Plce1 A G 19: 38,737,933 E1448G probably damaging Het
Plrg1 T C 3: 83,069,001 S326P possibly damaging Het
Pom121l2 T A 13: 21,981,682 V41E probably damaging Het
Preb G T 5: 30,956,329 S311* probably null Het
Prss33 T A 17: 23,834,749 D118V probably damaging Het
Pum1 C A 4: 130,771,898 Y1008* probably null Het
Rassf2 G A 2: 132,004,406 R144C probably damaging Het
Rnf123 A T 9: 108,067,505 M429K probably benign Het
Rtl1 T A 12: 109,590,857 H1516L probably benign Het
Scyl3 T A 1: 163,936,438 N124K probably damaging Het
Sec24b A G 3: 130,007,571 S488P probably benign Het
Shc4 T A 2: 125,678,698 D277V probably damaging Het
Sorl1 T A 9: 42,001,518 D1389V probably damaging Het
Srcap T A 7: 127,559,640 I2896N unknown Het
Steap3 T A 1: 120,227,834 Y465F probably benign Het
Tecta C A 9: 42,372,897 C964F probably damaging Het
Thap1 AGCAGCATCTGCTCG AG 8: 26,160,854 probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmem178b G A 6: 40,004,247 W72* probably null Het
Tmem235 T G 11: 117,860,839 Y30D probably damaging Het
Tpst1 C A 5: 130,134,460 T366K probably benign Het
Trdv2-1 C A 14: 53,946,391 P27T probably benign Het
Trim37 G T 11: 87,167,502 L335F possibly damaging Het
Usp9y G A Y: 1,341,873 R1331W probably damaging Het
Vmn1r1 T G 1: 182,157,437 H221P probably damaging Het
Vmn2r6 A T 3: 64,547,250 S543T probably benign Het
Wdpcp C T 11: 21,711,522 P265S probably benign Het
Wdr64 T C 1: 175,772,305 L566P possibly damaging Het
Zfp248 A G 6: 118,428,930 I566T possibly damaging Het
Zfp595 T A 13: 67,317,399 I270F probably damaging Het
Zfp715 A G 7: 43,299,423 L371P probably damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0584:Myh13 UTSW 11 67360374 nonsense probably null
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8965:Myh13 UTSW 11 67364606 missense probably benign 0.00
R9088:Myh13 UTSW 11 67352059 missense probably damaging 1.00
R9151:Myh13 UTSW 11 67361323 missense probably damaging 1.00
R9154:Myh13 UTSW 11 67362492 missense probably benign
R9182:Myh13 UTSW 11 67337753 missense probably damaging 1.00
R9393:Myh13 UTSW 11 67352068 missense probably benign
R9446:Myh13 UTSW 11 67364499 missense probably benign 0.01
R9474:Myh13 UTSW 11 67364886 missense
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCTAACTTGTCTGGCAAACGC -3'
(R):5'- TGACAATTTCTTCCTTGAGAGGG -3'

Sequencing Primer
(F):5'- AAACGCCTATGCCGTGAG -3'
(R):5'- TCCTTGAGAGGGAGATATTGAGGC -3'
Posted On 2022-04-18