Incidental Mutation 'R9334:Hrg'
ID 707026
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Name histidine-rich glycoprotein
Synonyms D18020, D16JH2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R9334 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 22951072-22961656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22961311 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 446 (H446Q)
Ref Sequence ENSEMBL: ENSMUSP00000023590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023590
AA Change: H446Q
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: H446Q

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232422
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,454 F873L possibly damaging Het
Actr1b A T 1: 36,700,170 I346N probably damaging Het
Adam6b A C 12: 113,491,148 E528D probably damaging Het
Ang A G 14: 51,101,560 M53V possibly damaging Het
Ankrd26 G A 6: 118,532,301 A601V probably benign Het
Atp6v0d2 A G 4: 19,890,695 L155P probably damaging Het
C87499 A T 4: 88,629,949 I73K probably damaging Het
Cacna1a T C 8: 84,569,965 V1204A probably damaging Het
Car4 A G 11: 84,964,589 I183V probably benign Het
Ccdc149 G T 5: 52,420,829 A87E possibly damaging Het
Ccdc88b A G 19: 6,856,173 M208T possibly damaging Het
Ccnt2 T C 1: 127,795,309 L162S probably damaging Het
Cd27 A G 6: 125,236,755 probably null Het
Cfap44 C A 16: 44,419,291 T567K probably damaging Het
Cpne5 C T 17: 29,204,699 V152M probably benign Het
Cyp2u1 C T 3: 131,298,416 V152M probably damaging Het
Dnajc13 A T 9: 104,174,460 F1733I probably benign Het
Dopey1 A G 9: 86,520,974 Y1409C probably damaging Het
Ecm2 T C 13: 49,524,339 M367T probably benign Het
Eif4g2 A G 7: 111,074,824 S658P possibly damaging Het
Exoc3l4 T C 12: 111,430,683 L666P probably damaging Het
Fbxl4 G A 4: 22,376,778 M71I probably damaging Het
Fbxw10 T C 11: 62,875,084 S727P possibly damaging Het
Fem1b A T 9: 62,796,322 L552* probably null Het
Filip1 A T 9: 79,818,457 V960D probably benign Het
Glipr1l3 A T 10: 112,144,043 M198K probably benign Het
Gm19410 T A 8: 35,803,568 C1216* probably null Het
Gmps T A 3: 63,982,443 V81E probably damaging Het
Gpr150 G T 13: 76,055,984 Q281K probably benign Het
Grsf1 A G 5: 88,672,610 V221A probably damaging Het
Gsc T A 12: 104,473,094 I8F probably damaging Het
Homer2 A T 7: 81,611,330 C284* probably null Het
Jag1 C T 2: 137,101,673 R201H probably damaging Het
Kctd15 C T 7: 34,642,058 R148H possibly damaging Het
Klhdc7a G A 4: 139,966,182 R485C probably benign Het
Ldhd T A 8: 111,627,348 I407F probably benign Het
Lgals12 G A 19: 7,600,721 R192C probably benign Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Lum A T 10: 97,568,485 I81F probably damaging Het
Map1b G T 13: 99,431,640 D1524E unknown Het
Marveld3 A G 8: 109,948,404 L260S probably damaging Het
Mms19 C T 19: 41,953,764 R555H probably benign Het
Mrpl37 G A 4: 107,064,408 T208I probably benign Het
Mug1 A T 6: 121,861,531 T498S probably benign Het
Myo3b T C 2: 70,217,016 C289R probably damaging Het
Myo7a A T 7: 98,067,162 F1459Y probably damaging Het
Neurl4 C A 11: 69,905,966 R518S probably damaging Het
Nmnat2 T G 1: 153,073,839 V43G probably damaging Het
Olfr133 T A 17: 38,148,949 F120L probably benign Het
Olfr222 T C 11: 59,571,446 Y98C probably damaging Het
Olfr804 A G 10: 129,705,814 N312S probably benign Het
Otog A G 7: 46,259,929 T608A possibly damaging Het
Pck2 G A 14: 55,547,826 R482Q probably damaging Het
Pcx G A 19: 4,620,504 M1013I probably benign Het
Pex13 A G 11: 23,655,630 M200T probably benign Het
Pigt CCGTGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCATGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCC CCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGTGCCCGTGGTGTACCCCCTCTCTAGTCCTGTGAGCCCGTGGTGTACCCCCTCTCTAGTCCGGCGCGCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCATGGTGTGCCCCCTCTCTAGTCCGGCGCTCCCGTGGTGTGCCCCCTCTCTAGTCCGGCGAGCCCGTGGTGTGCCCCCTCTCTAGTCC 2: 164,507,500 probably null Het
Ptpn4 T C 1: 119,802,384 H26R probably benign Het
Ralgps2 T A 1: 156,888,029 E72V probably damaging Het
Scube1 A T 15: 83,628,063 C396S possibly damaging Het
Sec23b T A 2: 144,568,630 N283K possibly damaging Het
Setx T A 2: 29,154,020 Y1800* probably null Het
Sgce G T 6: 4,707,205 S213R probably damaging Het
Slc36a2 T C 11: 55,185,039 probably benign Het
Sult5a1 A T 8: 123,148,407 D129E probably damaging Het
Tacr1 A T 6: 82,403,932 H108L probably damaging Het
Tnfsf10 T A 3: 27,335,347 Y186N probably damaging Het
Ttc37 C A 13: 76,132,957 T704N possibly damaging Het
Unc80 T C 1: 66,649,760 S2428P possibly damaging Het
Vwf G A 6: 125,677,946 R2535H Het
Zfp532 A G 18: 65,623,057 I20M probably damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1828:Hrg UTSW 16 22956103 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R5236:Hrg UTSW 16 22961513 unclassified probably benign
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6054:Hrg UTSW 16 22953662 missense probably benign 0.05
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
R7516:Hrg UTSW 16 22961298 missense unknown
R7606:Hrg UTSW 16 22951123 start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22961043 missense unknown
R8349:Hrg UTSW 16 22961536 missense unknown
R8449:Hrg UTSW 16 22961536 missense unknown
R8973:Hrg UTSW 16 22959218 missense probably benign 0.22
R8998:Hrg UTSW 16 22953705 missense probably damaging 0.99
Z1177:Hrg UTSW 16 22953712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCATCCTTGTCATGGAC -3'
(R):5'- AAGGGCTGAATCTCTGGTTG -3'

Sequencing Primer
(F):5'- GCATCCTTGTCATGGACATCGTC -3'
(R):5'- CTGAATCTCTGGTTGTAGGGATC -3'
Posted On 2022-04-18