Incidental Mutation 'R9335:Lrp2'
ID 707040
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms Gp330, D230004K18Rik, b2b1625.2Clo, Megalin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9335 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 69424340-69586065 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69428639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 4569 (I4569T)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080953
AA Change: I4569T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: I4569T

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik G T 16: 91,055,942 T102K probably damaging Het
Afm A T 5: 90,550,227 D496V probably damaging Het
Aldh1l2 C T 10: 83,506,646 M546I probably damaging Het
Apol7c G T 15: 77,525,689 N352K probably benign Het
Arfgef1 A T 1: 10,158,011 D1319E probably damaging Het
Atl2 A G 17: 79,852,778 I460T probably benign Het
Brms1l C A 12: 55,841,646 T73K possibly damaging Het
C1rl A T 6: 124,505,382 H154L probably benign Het
Cacna2d4 T A 6: 119,302,053 L709Q probably damaging Het
Cd101 A T 3: 101,008,115 V716D probably benign Het
Cd177 A G 7: 24,744,286 S796P probably benign Het
D430041D05Rik A T 2: 104,248,329 M530K probably damaging Het
Dcbld2 A T 16: 58,451,778 Q399L probably benign Het
Dennd4b T C 3: 90,268,304 Y138H probably damaging Het
Dmxl1 A G 18: 49,859,120 N311S probably damaging Het
Dnaic2 A G 11: 114,734,663 I107V probably benign Het
Dync2h1 A C 9: 7,112,149 V2480G possibly damaging Het
Ect2l T A 10: 18,201,284 T24S probably null Het
Egfr C A 11: 16,870,991 T302K probably damaging Het
Eid1 T G 2: 125,673,658 I156S possibly damaging Het
Elmod1 A T 9: 53,935,832 W21R probably benign Het
Enah G A 1: 181,921,885 P463L probably damaging Het
Epha7 A G 4: 28,966,529 Y602C probably benign Het
Ermap T A 4: 119,178,348 Y481F probably damaging Het
Fam114a2 G T 11: 57,506,922 T231N possibly damaging Het
Gdap1 A G 1: 17,161,165 T245A probably benign Het
Glmp T A 3: 88,328,256 V368D probably damaging Het
Gm10203 C T 6: 149,130,317 A40V unknown Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hao2 C A 3: 98,883,694 V55L possibly damaging Het
Hemgn A T 4: 46,394,647 S488T probably benign Het
Ighv12-3 C T 12: 114,366,692 G61E probably damaging Het
Itga2b T C 11: 102,455,652 E986G probably damaging Het
Laptm5 T G 4: 130,929,528 S167A Het
Lmtk3 A T 7: 45,792,741 Y377F probably damaging Het
Magi2 A G 5: 20,661,265 N176D Het
Mcf2l C A 8: 13,000,812 H356N possibly damaging Het
Mettl4 T A 17: 94,735,508 Y300F probably damaging Het
Naaladl2 T G 3: 24,413,368 K307N possibly damaging Het
Olfr169 G A 16: 19,566,763 T40I probably benign Het
Olfr43 T A 11: 74,207,006 D70V probably damaging Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr765 C T 10: 129,046,745 G106E probably damaging Het
Phip T A 9: 82,932,926 M248L probably benign Het
Picalm A G 7: 90,176,283 T300A probably benign Het
Ppa1 T G 10: 61,648,783 V19G possibly damaging Het
Ppp4r3a T C 12: 101,040,754 Y793C probably damaging Het
Prlr A T 15: 10,325,271 I177F probably benign Het
Prodh C A 16: 18,076,296 G457V probably damaging Het
Prrt3 T C 6: 113,498,097 K55E probably benign Het
Prx G T 7: 27,518,071 V805L probably damaging Het
Ptk6 T G 2: 181,202,353 D51A probably damaging Het
Rec114 T A 9: 58,657,758 Q205L probably null Het
Rfwd3 T G 8: 111,279,935 K510Q possibly damaging Het
Sdhb C T 4: 140,972,939 R117C probably benign Het
Serinc2 T G 4: 130,264,427 T21P probably benign Het
Serpinb3a A C 1: 107,047,156 F216V probably damaging Het
Sertm1 T C 3: 54,899,508 D32G probably damaging Het
Setx A G 2: 29,145,951 D816G probably benign Het
Sfxn4 T A 19: 60,851,056 N188I probably damaging Het
Slc26a4 T C 12: 31,525,554 D711G probably damaging Het
Sp9 T C 2: 73,274,277 F392L probably damaging Het
Ssbp1 T C 6: 40,478,021 L138P probably damaging Het
Sv2a G A 3: 96,185,272 G96E probably damaging Het
Tbc1d9 G T 8: 83,210,531 G81C possibly damaging Het
Tmem67 G A 4: 12,040,640 Q968* probably null Het
Tnni2 T C 7: 142,444,266 S169P probably damaging Het
Tpk1 T C 6: 43,469,150 probably null Het
Unc13b T A 4: 43,216,123 Y141N possibly damaging Het
Unc13b A T 4: 43,255,551 E1057D probably damaging Het
Usf3 G T 16: 44,221,573 G2139C probably damaging Het
Vmn1r36 A T 6: 66,716,446 Y148* probably null Het
Vmn2r42 A C 7: 8,194,759 M287R probably damaging Het
Vmn2r60 A T 7: 42,194,908 H565L probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Zfp974 A T 7: 27,912,051 M83K probably benign Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69507779 missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69486280 missense probably benign 0.00
IGL00782:Lrp2 APN 2 69501645 missense probably benign 0.14
IGL00821:Lrp2 APN 2 69459516 missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69521881 missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69469436 missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69524073 missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69492432 nonsense probably null
IGL01131:Lrp2 APN 2 69499239 missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69510984 missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69503526 missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69552470 splice site probably benign
IGL01375:Lrp2 APN 2 69478566 splice site probably benign
IGL01384:Lrp2 APN 2 69483502 missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69453812 missense probably null 1.00
IGL01411:Lrp2 APN 2 69482267 missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69525286 missense probably benign
IGL01444:Lrp2 APN 2 69443716 missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69472439 missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69492460 missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69428706 missense probably benign
IGL01761:Lrp2 APN 2 69481235 missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69486184 missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69483601 missense probably benign 0.08
IGL02015:Lrp2 APN 2 69527578 missense probably benign 0.00
IGL02104:Lrp2 APN 2 69510418 missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69537616 missense probably benign 0.01
IGL02134:Lrp2 APN 2 69513379 critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69466880 missense probably benign 0.01
IGL02212:Lrp2 APN 2 69451264 missense probably benign 0.00
IGL02240:Lrp2 APN 2 69535046 missense probably benign
IGL02248:Lrp2 APN 2 69482808 missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69464636 missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69469633 missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69461305 missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69521773 missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69464801 splice site probably benign
IGL02508:Lrp2 APN 2 69503430 missense probably benign 0.04
IGL02751:Lrp2 APN 2 69533462 missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69506736 missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69455510 missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69487837 missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69455453 splice site probably benign
IGL02990:Lrp2 APN 2 69441396 missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69537553 missense probably benign 0.43
IGL03038:Lrp2 APN 2 69475464 missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69483133 missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69454833 missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69477026 missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69549042 missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69455452 splice site probably benign
IGL03163:Lrp2 APN 2 69501526 nonsense probably null
IGL03164:Lrp2 APN 2 69464699 missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69523194 missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69466265 missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69438478 splice site probably benign
IGL03288:Lrp2 APN 2 69426039 missense probably benign 0.02
IGL03350:Lrp2 APN 2 69438453 missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69431152 missense probably damaging 1.00
casual UTSW 2 69499263 missense probably benign
nonchalant UTSW 2 69489329 missense probably damaging 1.00
Presto UTSW 2 69459531 nonsense probably null
relaxed UTSW 2 69535005 missense probably damaging 1.00
unguarded UTSW 2 69465758 missense probably benign 0.00
Unintended UTSW 2 69518443 missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69426027 missense probably benign 0.00
BB019:Lrp2 UTSW 2 69426027 missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69505304 missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69458448 missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69537538 missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69475403 missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0044:Lrp2 UTSW 2 69527555 missense probably benign 0.01
R0044:Lrp2 UTSW 2 69527555 missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69465627 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69477040 missense probably benign
R0167:Lrp2 UTSW 2 69425658 missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69537563 missense probably null 1.00
R0243:Lrp2 UTSW 2 69428630 missense probably benign 0.00
R0308:Lrp2 UTSW 2 69482982 splice site probably benign
R0323:Lrp2 UTSW 2 69469639 missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69535043 missense probably benign 0.10
R0374:Lrp2 UTSW 2 69430307 missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69456858 missense probably damaging 0.99
R0391:Lrp2 UTSW 2 69460337 splice site probably benign
R0395:Lrp2 UTSW 2 69433077 missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69479148 missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69525234 missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69507801 missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69511017 missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69428654 missense probably benign 0.00
R0544:Lrp2 UTSW 2 69491931 missense probably benign 0.18
R0548:Lrp2 UTSW 2 69537638 splice site probably benign
R0593:Lrp2 UTSW 2 69467006 missense probably benign
R0608:Lrp2 UTSW 2 69486243 missense probably benign 0.02
R0633:Lrp2 UTSW 2 69448120 missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69451380 missense probably benign 0.19
R0718:Lrp2 UTSW 2 69510948 missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69448169 missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69507990 missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69518365 missense probably benign 0.32
R0885:Lrp2 UTSW 2 69482353 missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69487838 missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69524036 missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69523302 splice site probably null
R1301:Lrp2 UTSW 2 69428604 missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69456918 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69460477 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69483394 missense probably damaging 0.99
R1529:Lrp2 UTSW 2 69523182 missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69500730 missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69502610 missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69502661 missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69466763 critical splice donor site probably null
R1689:Lrp2 UTSW 2 69503529 missense probably benign 0.09
R1693:Lrp2 UTSW 2 69510418 missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69496489 missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69503530 missense probably benign 0.04
R1834:Lrp2 UTSW 2 69466880 missense probably benign 0.01
R1921:Lrp2 UTSW 2 69523287 missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69467090 missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69507843 missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2093:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2108:Lrp2 UTSW 2 69506624 missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69483385 missense probably benign 0.05
R2122:Lrp2 UTSW 2 69483707 missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69511067 missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69467028 missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69511010 missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69491847 missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69506374 splice site probably null
R2984:Lrp2 UTSW 2 69425814 splice site probably null
R3085:Lrp2 UTSW 2 69467135 missense probably benign 0.05
R3103:Lrp2 UTSW 2 69431984 missense probably benign 0.00
R3727:Lrp2 UTSW 2 69510429 missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3731:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3764:Lrp2 UTSW 2 69496336 missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69505105 missense probably benign 0.34
R3778:Lrp2 UTSW 2 69509204 missense probably benign 0.00
R3808:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69426012 missense probably benign 0.03
R3852:Lrp2 UTSW 2 69537565 missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69459472 critical splice donor site probably null
R3877:Lrp2 UTSW 2 69549047 missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69506376 missense probably benign
R4081:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69430262 critical splice donor site probably null
R4193:Lrp2 UTSW 2 69467143 missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69480094 missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69425991 nonsense probably null
R4352:Lrp2 UTSW 2 69432182 critical splice donor site probably null
R4407:Lrp2 UTSW 2 69502517 missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69467169 missense probably benign 0.09
R4416:Lrp2 UTSW 2 69527231 missense probably benign 0.18
R4426:Lrp2 UTSW 2 69506348 missense probably benign 0.00
R4510:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69513285 missense probably benign 0.13
R4591:Lrp2 UTSW 2 69536075 missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69458427 nonsense probably null
R4622:Lrp2 UTSW 2 69460349 missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69489129 splice site probably null
R4633:Lrp2 UTSW 2 69461417 missense probably benign 0.16
R4636:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69466993 missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69489298 missense probably benign 0.02
R4712:Lrp2 UTSW 2 69506551 missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69487966 missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69481173 missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69533555 missense probably benign
R4733:Lrp2 UTSW 2 69533555 missense probably benign
R4777:Lrp2 UTSW 2 69482264 missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69459715 missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69537956 missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69469411 missense probably benign 0.06
R4845:Lrp2 UTSW 2 69509241 missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69479113 missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69472368 missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69535988 missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69481388 missense probably benign 0.01
R5075:Lrp2 UTSW 2 69465758 missense probably benign 0.00
R5078:Lrp2 UTSW 2 69501530 missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69489158 missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69501490 missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69430342 missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69552349 splice site probably null
R5223:Lrp2 UTSW 2 69524053 missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69456819 splice site probably null
R5267:Lrp2 UTSW 2 69548978 missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69513354 missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69525228 missense probably benign 0.01
R5355:Lrp2 UTSW 2 69454838 nonsense probably null
R5356:Lrp2 UTSW 2 69464708 missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69459560 missense probably benign 0.04
R5486:Lrp2 UTSW 2 69437465 missense probably benign 0.04
R5554:Lrp2 UTSW 2 69552424 missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69451288 missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69464624 missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69499263 missense probably benign
R5605:Lrp2 UTSW 2 69523299 missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69472418 missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69519914 missense probably null 0.80
R5686:Lrp2 UTSW 2 69511061 missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69502553 missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69451382 missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69509147 missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69466877 missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69455525 missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69480153 missense probably benign 0.00
R5892:Lrp2 UTSW 2 69442776 missense probably benign
R5951:Lrp2 UTSW 2 69496323 splice site probably null
R5974:Lrp2 UTSW 2 69459548 missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69535005 missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69506754 missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69483557 missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69511001 missense probably benign 0.00
R6177:Lrp2 UTSW 2 69510419 frame shift probably null
R6180:Lrp2 UTSW 2 69503524 missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69469478 missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69466340 missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69436681 missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69438467 missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69483443 missense probably benign 0.02
R6385:Lrp2 UTSW 2 69495784 missense probably benign 0.22
R6429:Lrp2 UTSW 2 69461287 missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69505156 missense probably benign 0.00
R6524:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69509303 missense probably benign 0.00
R6594:Lrp2 UTSW 2 69439923 missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69469405 missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69453858 missense probably benign 0.01
R6718:Lrp2 UTSW 2 69483780 missense probably benign 0.09
R6736:Lrp2 UTSW 2 69448211 missense probably benign 0.02
R6738:Lrp2 UTSW 2 69458488 missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69483904 missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69518443 missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69513268 missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69513377 missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69524141 missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69510502 missense probably benign
R6902:Lrp2 UTSW 2 69459503 missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69472365 missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69489305 missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69472455 missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69483208 missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69483028 missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69521787 missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69465745 missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69454808 critical splice donor site probably null
R7150:Lrp2 UTSW 2 69488051 missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69506573 missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69433072 missense probably benign 0.11
R7204:Lrp2 UTSW 2 69472533 missense probably benign 0.25
R7275:Lrp2 UTSW 2 69459531 nonsense probably null
R7278:Lrp2 UTSW 2 69486352 missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69482381 missense probably benign 0.04
R7315:Lrp2 UTSW 2 69491822 missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69479290 missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69448142 missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69472397 missense probably benign 0.04
R7366:Lrp2 UTSW 2 69483806 missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69500692 missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69432213 missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69459674 missense probably damaging 0.99
R7451:Lrp2 UTSW 2 69513333 missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69537581 missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69516403 missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69477008 critical splice donor site probably null
R7664:Lrp2 UTSW 2 69506732 missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69489237 missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69479343 critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69496438 missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69503388 missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69501539 missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69501539 missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69464784 missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69507809 missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69507810 missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69458479 missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69441366 missense probably benign 0.00
R7912:Lrp2 UTSW 2 69428672 missense probably benign 0.03
R7923:Lrp2 UTSW 2 69438388 missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69426027 missense probably benign 0.00
R7940:Lrp2 UTSW 2 69432197 missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69503523 missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69506505 missense probably benign 0.02
R8084:Lrp2 UTSW 2 69509369 missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69448129 missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69464745 missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69506453 missense probably benign
R8129:Lrp2 UTSW 2 69430280 missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69482998 missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69489329 missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69481267 nonsense probably null
R8247:Lrp2 UTSW 2 69431087 missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69491924 missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69516484 missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69514241 nonsense probably null
R8427:Lrp2 UTSW 2 69451297 missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69491906 missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69514241 nonsense probably null
R8529:Lrp2 UTSW 2 69500642 missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69472460 missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69448239 missense probably benign 0.39
R8698:Lrp2 UTSW 2 69458423 missense probably benign 0.37
R8708:Lrp2 UTSW 2 69459613 missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69443794 missense probably benign 0.04
R8723:Lrp2 UTSW 2 69486304 missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69552401 missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69549038 missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69511004 missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69501652 missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69519916 missense probably benign 0.01
R9155:Lrp2 UTSW 2 69461369 nonsense probably null
R9173:Lrp2 UTSW 2 69469387 missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69503547 missense probably benign 0.09
R9256:Lrp2 UTSW 2 69510959 missense probably benign 0.03
R9291:Lrp2 UTSW 2 69480035 missense probably damaging 1.00
R9357:Lrp2 UTSW 2 69506573 missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69527635 missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69458488 missense probably damaging 1.00
RF016:Lrp2 UTSW 2 69509205 missense probably benign
X0011:Lrp2 UTSW 2 69519998 missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69436600 missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69480042 missense possibly damaging 0.66
Z1176:Lrp2 UTSW 2 69507881 missense possibly damaging 0.88
Z1177:Lrp2 UTSW 2 69451280 missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69472453 missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69496468 missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69501641 missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69509289 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATGTTGTGTGAATGTCCC -3'
(R):5'- GCTGCTAGTGTCACTTATCAGATTG -3'

Sequencing Primer
(F):5'- GTGTGAATGTCCCAGATTCTATGTCC -3'
(R):5'- ATTGAAAAGGTACGTGACTGTGTC -3'
Posted On 2022-04-18