Incidental Mutation 'R0741:Vgll1'
ID70706
Institutional Source Beutler Lab
Gene Symbol Vgll1
Ensembl Gene ENSMUSG00000031131
Gene Namevestigial like family member 1
SynonymsTondu
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0741 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location57088106-57106540 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 57096284 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033465] [ENSMUST00000114745] [ENSMUST00000114746] [ENSMUST00000141936]
Predicted Effect unknown
Transcript: ENSMUST00000033465
AA Change: D79V
SMART Domains Protein: ENSMUSP00000033465
Gene: ENSMUSG00000031131
AA Change: D79V

DomainStartEndE-ValueType
Pfam:Vg_Tdu 21 51 4.5e-21 PFAM
internal_repeat_1 180 198 3.9e-5 PROSPERO
internal_repeat_1 206 224 3.9e-5 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000114745
AA Change: D79V
SMART Domains Protein: ENSMUSP00000110393
Gene: ENSMUSG00000031131
AA Change: D79V

DomainStartEndE-ValueType
Pfam:Vg_Tdu 21 53 9.6e-26 PFAM
internal_repeat_1 180 198 3.9e-5 PROSPERO
internal_repeat_1 206 224 3.9e-5 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000114746
AA Change: D79V
SMART Domains Protein: ENSMUSP00000110394
Gene: ENSMUSG00000031131
AA Change: D79V

DomainStartEndE-ValueType
Pfam:Vg_Tdu 21 53 9.6e-26 PFAM
internal_repeat_1 180 198 3.9e-5 PROSPERO
internal_repeat_1 206 224 3.9e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000141936
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds proteins of the TEA domain family of transcription factors (TEFs) through the Vg (vestigial) homology region found in its N-terminus. It may thus function as a specific coactivator for the mammalian TEFs. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Other mutations in Vgll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Vgll1 APN X 57099209 unclassified probably benign
R2114:Vgll1 UTSW X 57092430 missense probably damaging 0.96
R2115:Vgll1 UTSW X 57092430 missense probably damaging 0.96
R2117:Vgll1 UTSW X 57092430 missense probably damaging 0.96
R4665:Vgll1 UTSW X 57092432 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCAGCCATTCAACTGAAGACACC -3'
(R):5'- CCCATACAGCAAGGCACTTCCTTT -3'

Sequencing Primer
(F):5'- TCTAGCAAACAGACTAGGTGC -3'
(R):5'- TTGAAGcacacacacacacac -3'
Posted On2013-09-30