Incidental Mutation 'R0741:Magee2'
ID70707
Institutional Source Beutler Lab
Gene Symbol Magee2
Ensembl Gene ENSMUSG00000031224
Gene Namemelanoma antigen, family E, 2
Synonyms9630059J11Rik, Mage-e2
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0741 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location104854952-104857267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104855866 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 393 (L393P)
Ref Sequence ENSEMBL: ENSMUSP00000033575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033575]
Predicted Effect probably damaging
Transcript: ENSMUST00000033575
AA Change: L393P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033575
Gene: ENSMUSG00000031224
AA Change: L393P

DomainStartEndE-ValueType
MAGE 95 266 1.86e-57 SMART
MAGE 318 480 3.42e-47 SMART
low complexity region 500 516 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E subfamily of MAGE (melanoma antigen-encoding gene) gene family. The gene is intronless and the encoded protein has two of the MAGE domains which are characteristic of MAGE family proteins. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Magee2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magee2 APN X 104856841 missense probably benign 0.05
IGL01700:Magee2 APN X 104855968 missense possibly damaging 0.49
IGL02377:Magee2 APN X 104856793 missense possibly damaging 0.86
IGL03231:Magee2 APN X 104856338 missense probably damaging 1.00
IGL03366:Magee2 APN X 104855528 nonsense probably null
X0009:Magee2 UTSW X 104856842 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATTTCATGGTGAGCCCGAGGAC -3'
(R):5'- GTCACTGAGGAGTTGCTGCCTATC -3'

Sequencing Primer
(F):5'- AGCAGCTCGTATTCAACTGG -3'
(R):5'- CTGCCTATCCATCAGGATGAG -3'
Posted On2013-09-30