Incidental Mutation 'R9335:Aldh1l2'
ID 707089
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9335 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83342510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 546 (M546I)
Ref Sequence ENSEMBL: ENSMUSP00000020497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably damaging
Transcript: ENSMUST00000020497
AA Change: M546I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: M546I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146640
AA Change: M433I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: M433I

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik G T 16: 90,852,830 (GRCm39) T102K probably damaging Het
Afm A T 5: 90,698,086 (GRCm39) D496V probably damaging Het
Apol7c G T 15: 77,409,889 (GRCm39) N352K probably benign Het
Arfgef1 A T 1: 10,228,236 (GRCm39) D1319E probably damaging Het
Atl2 A G 17: 80,160,207 (GRCm39) I460T probably benign Het
Brms1l C A 12: 55,888,431 (GRCm39) T73K possibly damaging Het
C1rl A T 6: 124,482,341 (GRCm39) H154L probably benign Het
Cacna2d4 T A 6: 119,279,014 (GRCm39) L709Q probably damaging Het
Cd101 A T 3: 100,915,431 (GRCm39) V716D probably benign Het
Cd177 A G 7: 24,443,711 (GRCm39) S796P probably benign Het
D430041D05Rik A T 2: 104,078,674 (GRCm39) M530K probably damaging Het
Dcbld2 A T 16: 58,272,141 (GRCm39) Q399L probably benign Het
Dennd4b T C 3: 90,175,611 (GRCm39) Y138H probably damaging Het
Dmxl1 A G 18: 49,992,187 (GRCm39) N311S probably damaging Het
Dnai2 A G 11: 114,625,489 (GRCm39) I107V probably benign Het
Dync2h1 A C 9: 7,112,149 (GRCm39) V2480G possibly damaging Het
Ect2l T A 10: 18,077,032 (GRCm39) T24S probably null Het
Egfr C A 11: 16,820,991 (GRCm39) T302K probably damaging Het
Eid1 T G 2: 125,515,578 (GRCm39) I156S possibly damaging Het
Elmod1 A T 9: 53,843,116 (GRCm39) W21R probably benign Het
Enah G A 1: 181,749,450 (GRCm39) P463L probably damaging Het
Epha7 A G 4: 28,966,529 (GRCm39) Y602C probably benign Het
Ermap T A 4: 119,035,545 (GRCm39) Y481F probably damaging Het
Fam114a2 G T 11: 57,397,748 (GRCm39) T231N possibly damaging Het
Gdap1 A G 1: 17,231,389 (GRCm39) T245A probably benign Het
Glmp T A 3: 88,235,563 (GRCm39) V368D probably damaging Het
Gm10203 C T 6: 149,031,815 (GRCm39) A40V unknown Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 141,719,157 (GRCm39) probably benign Het
Grid1 G A 14: 35,043,664 (GRCm39) D340N probably damaging Het
Hao2 C A 3: 98,791,010 (GRCm39) V55L possibly damaging Het
Hemgn A T 4: 46,394,647 (GRCm39) S488T probably benign Het
Ighv12-3 C T 12: 114,330,312 (GRCm39) G61E probably damaging Het
Itga2b T C 11: 102,346,478 (GRCm39) E986G probably damaging Het
Laptm5 T G 4: 130,656,839 (GRCm39) S167A Het
Lmtk3 A T 7: 45,442,165 (GRCm39) Y377F probably damaging Het
Lrp2 A G 2: 69,258,983 (GRCm39) I4569T probably benign Het
Magi2 A G 5: 20,866,263 (GRCm39) N176D Het
Mcf2l C A 8: 13,050,812 (GRCm39) H356N possibly damaging Het
Mettl4 T A 17: 95,042,936 (GRCm39) Y300F probably damaging Het
Naaladl2 T G 3: 24,467,532 (GRCm39) K307N possibly damaging Het
Or1a1b T A 11: 74,097,832 (GRCm39) D70V probably damaging Het
Or2aj4 G A 16: 19,385,513 (GRCm39) T40I probably benign Het
Or51ag1 C T 7: 103,155,727 (GRCm39) R142H probably benign Het
Or6c8b C T 10: 128,882,614 (GRCm39) G106E probably damaging Het
Phip T A 9: 82,814,979 (GRCm39) M248L probably benign Het
Picalm A G 7: 89,825,491 (GRCm39) T300A probably benign Het
Ppa1 T G 10: 61,484,562 (GRCm39) V19G possibly damaging Het
Ppp4r3a T C 12: 101,007,013 (GRCm39) Y793C probably damaging Het
Prlr A T 15: 10,325,357 (GRCm39) I177F probably benign Het
Prodh C A 16: 17,894,160 (GRCm39) G457V probably damaging Het
Prrt3 T C 6: 113,475,058 (GRCm39) K55E probably benign Het
Prx G T 7: 27,217,496 (GRCm39) V805L probably damaging Het
Ptk6 T G 2: 180,844,146 (GRCm39) D51A probably damaging Het
Rec114 T A 9: 58,565,041 (GRCm39) Q205L probably null Het
Rfwd3 T G 8: 112,006,567 (GRCm39) K510Q possibly damaging Het
Sdhb C T 4: 140,700,250 (GRCm39) R117C probably benign Het
Serinc2 T G 4: 130,158,220 (GRCm39) T21P probably benign Het
Serpinb3a A C 1: 106,974,886 (GRCm39) F216V probably damaging Het
Sertm1 T C 3: 54,806,929 (GRCm39) D32G probably damaging Het
Setx A G 2: 29,035,963 (GRCm39) D816G probably benign Het
Sfxn4 T A 19: 60,839,494 (GRCm39) N188I probably damaging Het
Slc26a4 T C 12: 31,575,553 (GRCm39) D711G probably damaging Het
Sp9 T C 2: 73,104,621 (GRCm39) F392L probably damaging Het
Ssbp1 T C 6: 40,454,955 (GRCm39) L138P probably damaging Het
Sv2a G A 3: 96,092,588 (GRCm39) G96E probably damaging Het
Tbc1d9 G T 8: 83,937,160 (GRCm39) G81C possibly damaging Het
Tmem67 G A 4: 12,040,640 (GRCm39) Q968* probably null Het
Tnni2 T C 7: 141,998,003 (GRCm39) S169P probably damaging Het
Tpk1 T C 6: 43,446,084 (GRCm39) probably null Het
Unc13b T A 4: 43,216,123 (GRCm39) Y141N possibly damaging Het
Unc13b A T 4: 43,255,551 (GRCm39) E1057D probably damaging Het
Usf3 G T 16: 44,041,936 (GRCm39) G2139C probably damaging Het
Vmn1r36 A T 6: 66,693,430 (GRCm39) Y148* probably null Het
Vmn2r42 A C 7: 8,197,758 (GRCm39) M287R probably damaging Het
Vmn2r60 A T 7: 41,844,332 (GRCm39) H565L probably damaging Het
Zfp518a G A 19: 40,901,225 (GRCm39) V385I probably benign Het
Zfp974 A T 7: 27,611,476 (GRCm39) M83K probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCCATCTCAGAACTAAGG -3'
(R):5'- TCTGGACTAGTCTCTGGATTCTTAG -3'

Sequencing Primer
(F):5'- GGCCAAACCTGCTGCAAACTC -3'
(R):5'- CCTATACAGGGCTGGCATAC -3'
Posted On 2022-04-18