Incidental Mutation 'R9335:Ighv12-3'
ID 707099
Institutional Source Beutler Lab
Gene Symbol Ighv12-3
Ensembl Gene ENSMUSG00000076676
Gene Name immunoglobulin heavy variable V12-3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9335 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 114366521-114366954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 114366692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 61 (G61E)
Ref Sequence ENSEMBL: ENSMUSP00000100266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103485]
AlphaFold A0A075B5T1
Predicted Effect probably damaging
Transcript: ENSMUST00000103485
AA Change: G61E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100266
Gene: ENSMUSG00000076676
AA Change: G61E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGv 35 116 5.3e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik G T 16: 91,055,942 T102K probably damaging Het
Afm A T 5: 90,550,227 D496V probably damaging Het
Aldh1l2 C T 10: 83,506,646 M546I probably damaging Het
Apol7c G T 15: 77,525,689 N352K probably benign Het
Arfgef1 A T 1: 10,158,011 D1319E probably damaging Het
Atl2 A G 17: 79,852,778 I460T probably benign Het
Brms1l C A 12: 55,841,646 T73K possibly damaging Het
C1rl A T 6: 124,505,382 H154L probably benign Het
Cacna2d4 T A 6: 119,302,053 L709Q probably damaging Het
Cd101 A T 3: 101,008,115 V716D probably benign Het
Cd177 A G 7: 24,744,286 S796P probably benign Het
D430041D05Rik A T 2: 104,248,329 M530K probably damaging Het
Dcbld2 A T 16: 58,451,778 Q399L probably benign Het
Dennd4b T C 3: 90,268,304 Y138H probably damaging Het
Dmxl1 A G 18: 49,859,120 N311S probably damaging Het
Dnaic2 A G 11: 114,734,663 I107V probably benign Het
Dync2h1 A C 9: 7,112,149 V2480G possibly damaging Het
Ect2l T A 10: 18,201,284 T24S probably null Het
Egfr C A 11: 16,870,991 T302K probably damaging Het
Eid1 T G 2: 125,673,658 I156S possibly damaging Het
Elmod1 A T 9: 53,935,832 W21R probably benign Het
Enah G A 1: 181,921,885 P463L probably damaging Het
Epha7 A G 4: 28,966,529 Y602C probably benign Het
Ermap T A 4: 119,178,348 Y481F probably damaging Het
Fam114a2 G T 11: 57,506,922 T231N possibly damaging Het
Gdap1 A G 1: 17,161,165 T245A probably benign Het
Glmp T A 3: 88,328,256 V368D probably damaging Het
Gm10203 C T 6: 149,130,317 A40V unknown Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hao2 C A 3: 98,883,694 V55L possibly damaging Het
Hemgn A T 4: 46,394,647 S488T probably benign Het
Itga2b T C 11: 102,455,652 E986G probably damaging Het
Laptm5 T G 4: 130,929,528 S167A Het
Lmtk3 A T 7: 45,792,741 Y377F probably damaging Het
Lrp2 A G 2: 69,428,639 I4569T probably benign Het
Magi2 A G 5: 20,661,265 N176D Het
Mcf2l C A 8: 13,000,812 H356N possibly damaging Het
Mettl4 T A 17: 94,735,508 Y300F probably damaging Het
Naaladl2 T G 3: 24,413,368 K307N possibly damaging Het
Olfr169 G A 16: 19,566,763 T40I probably benign Het
Olfr43 T A 11: 74,207,006 D70V probably damaging Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr765 C T 10: 129,046,745 G106E probably damaging Het
Phip T A 9: 82,932,926 M248L probably benign Het
Picalm A G 7: 90,176,283 T300A probably benign Het
Ppa1 T G 10: 61,648,783 V19G possibly damaging Het
Ppp4r3a T C 12: 101,040,754 Y793C probably damaging Het
Prlr A T 15: 10,325,271 I177F probably benign Het
Prodh C A 16: 18,076,296 G457V probably damaging Het
Prrt3 T C 6: 113,498,097 K55E probably benign Het
Prx G T 7: 27,518,071 V805L probably damaging Het
Ptk6 T G 2: 181,202,353 D51A probably damaging Het
Rec114 T A 9: 58,657,758 Q205L probably null Het
Rfwd3 T G 8: 111,279,935 K510Q possibly damaging Het
Sdhb C T 4: 140,972,939 R117C probably benign Het
Serinc2 T G 4: 130,264,427 T21P probably benign Het
Serpinb3a A C 1: 107,047,156 F216V probably damaging Het
Sertm1 T C 3: 54,899,508 D32G probably damaging Het
Setx A G 2: 29,145,951 D816G probably benign Het
Sfxn4 T A 19: 60,851,056 N188I probably damaging Het
Slc26a4 T C 12: 31,525,554 D711G probably damaging Het
Sp9 T C 2: 73,274,277 F392L probably damaging Het
Ssbp1 T C 6: 40,478,021 L138P probably damaging Het
Sv2a G A 3: 96,185,272 G96E probably damaging Het
Tbc1d9 G T 8: 83,210,531 G81C possibly damaging Het
Tmem67 G A 4: 12,040,640 Q968* probably null Het
Tnni2 T C 7: 142,444,266 S169P probably damaging Het
Tpk1 T C 6: 43,469,150 probably null Het
Unc13b T A 4: 43,216,123 Y141N possibly damaging Het
Unc13b A T 4: 43,255,551 E1057D probably damaging Het
Usf3 G T 16: 44,221,573 G2139C probably damaging Het
Vmn1r36 A T 6: 66,716,446 Y148* probably null Het
Vmn2r42 A C 7: 8,194,759 M287R probably damaging Het
Vmn2r60 A T 7: 42,194,908 H565L probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Zfp974 A T 7: 27,912,051 M83K probably benign Het
Other mutations in Ighv12-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Ighv12-3 APN 12 114366953 start codon destroyed probably null 0.86
IGL02314:Ighv12-3 APN 12 114366801 missense probably damaging 1.00
IGL02701:Ighv12-3 APN 12 114366801 missense probably damaging 1.00
IGL02945:Ighv12-3 APN 12 114366717 missense probably damaging 1.00
R5569:Ighv12-3 UTSW 12 114366935 missense probably benign
R5952:Ighv12-3 UTSW 12 114366584 missense probably benign 0.07
R6542:Ighv12-3 UTSW 12 114366815 missense probably benign 0.41
R8962:Ighv12-3 UTSW 12 114366584 missense probably benign 0.07
R9131:Ighv12-3 UTSW 12 114366926 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTGTCTGTCTCCTGCACAG -3'
(R):5'- TGACAGTCCTTCCTGGTGAG -3'

Sequencing Primer
(F):5'- GCACAGTAATACATGGCTGTGTCC -3'
(R):5'- CCTGGTGAGTTGTGCCATTTCATAC -3'
Posted On 2022-04-18