Incidental Mutation 'R9335:Dmxl1'
ID 707110
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R9335 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 49832670-49965473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49859120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 311 (N311S)
Ref Sequence ENSEMBL: ENSMUSP00000045559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: N311S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: N311S

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000180611
AA Change: N311S

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: N311S

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik G T 16: 91,055,942 (GRCm38) T102K probably damaging Het
Afm A T 5: 90,550,227 (GRCm38) D496V probably damaging Het
Aldh1l2 C T 10: 83,506,646 (GRCm38) M546I probably damaging Het
Apol7c G T 15: 77,525,689 (GRCm38) N352K probably benign Het
Arfgef1 A T 1: 10,158,011 (GRCm38) D1319E probably damaging Het
Atl2 A G 17: 79,852,778 (GRCm38) I460T probably benign Het
Brms1l C A 12: 55,841,646 (GRCm38) T73K possibly damaging Het
C1rl A T 6: 124,505,382 (GRCm38) H154L probably benign Het
Cacna2d4 T A 6: 119,302,053 (GRCm38) L709Q probably damaging Het
Cd101 A T 3: 101,008,115 (GRCm38) V716D probably benign Het
Cd177 A G 7: 24,744,286 (GRCm38) S796P probably benign Het
D430041D05Rik A T 2: 104,248,329 (GRCm38) M530K probably damaging Het
Dcbld2 A T 16: 58,451,778 (GRCm38) Q399L probably benign Het
Dennd4b T C 3: 90,268,304 (GRCm38) Y138H probably damaging Het
Dnai2 A G 11: 114,734,663 (GRCm38) I107V probably benign Het
Dync2h1 A C 9: 7,112,149 (GRCm38) V2480G possibly damaging Het
Ect2l T A 10: 18,201,284 (GRCm38) T24S probably null Het
Egfr C A 11: 16,870,991 (GRCm38) T302K probably damaging Het
Eid1 T G 2: 125,673,658 (GRCm38) I156S possibly damaging Het
Elmod1 A T 9: 53,935,832 (GRCm38) W21R probably benign Het
Enah G A 1: 181,921,885 (GRCm38) P463L probably damaging Het
Epha7 A G 4: 28,966,529 (GRCm38) Y602C probably benign Het
Ermap T A 4: 119,178,348 (GRCm38) Y481F probably damaging Het
Fam114a2 G T 11: 57,506,922 (GRCm38) T231N possibly damaging Het
Gdap1 A G 1: 17,161,165 (GRCm38) T245A probably benign Het
Glmp T A 3: 88,328,256 (GRCm38) V368D probably damaging Het
Gm10203 C T 6: 149,130,317 (GRCm38) A40V unknown Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 (GRCm38) probably benign Het
Grid1 G A 14: 35,321,707 (GRCm38) D340N probably damaging Het
Hao2 C A 3: 98,883,694 (GRCm38) V55L possibly damaging Het
Hemgn A T 4: 46,394,647 (GRCm38) S488T probably benign Het
Ighv12-3 C T 12: 114,366,692 (GRCm38) G61E probably damaging Het
Itga2b T C 11: 102,455,652 (GRCm38) E986G probably damaging Het
Laptm5 T G 4: 130,929,528 (GRCm38) S167A Het
Lmtk3 A T 7: 45,792,741 (GRCm38) Y377F probably damaging Het
Lrp2 A G 2: 69,428,639 (GRCm38) I4569T probably benign Het
Magi2 A G 5: 20,661,265 (GRCm38) N176D Het
Mcf2l C A 8: 13,000,812 (GRCm38) H356N possibly damaging Het
Mettl4 T A 17: 94,735,508 (GRCm38) Y300F probably damaging Het
Naaladl2 T G 3: 24,413,368 (GRCm38) K307N possibly damaging Het
Or1a1b T A 11: 74,207,006 (GRCm38) D70V probably damaging Het
Or2aj4 G A 16: 19,566,763 (GRCm38) T40I probably benign Het
Or51ag1 C T 7: 103,506,520 (GRCm38) R142H probably benign Het
Or6c8b C T 10: 129,046,745 (GRCm38) G106E probably damaging Het
Phip T A 9: 82,932,926 (GRCm38) M248L probably benign Het
Picalm A G 7: 90,176,283 (GRCm38) T300A probably benign Het
Ppa1 T G 10: 61,648,783 (GRCm38) V19G possibly damaging Het
Ppp4r3a T C 12: 101,040,754 (GRCm38) Y793C probably damaging Het
Prlr A T 15: 10,325,271 (GRCm38) I177F probably benign Het
Prodh C A 16: 18,076,296 (GRCm38) G457V probably damaging Het
Prrt3 T C 6: 113,498,097 (GRCm38) K55E probably benign Het
Prx G T 7: 27,518,071 (GRCm38) V805L probably damaging Het
Ptk6 T G 2: 181,202,353 (GRCm38) D51A probably damaging Het
Rec114 T A 9: 58,657,758 (GRCm38) Q205L probably null Het
Rfwd3 T G 8: 111,279,935 (GRCm38) K510Q possibly damaging Het
Sdhb C T 4: 140,972,939 (GRCm38) R117C probably benign Het
Serinc2 T G 4: 130,264,427 (GRCm38) T21P probably benign Het
Serpinb3a A C 1: 107,047,156 (GRCm38) F216V probably damaging Het
Sertm1 T C 3: 54,899,508 (GRCm38) D32G probably damaging Het
Setx A G 2: 29,145,951 (GRCm38) D816G probably benign Het
Sfxn4 T A 19: 60,851,056 (GRCm38) N188I probably damaging Het
Slc26a4 T C 12: 31,525,554 (GRCm38) D711G probably damaging Het
Sp9 T C 2: 73,274,277 (GRCm38) F392L probably damaging Het
Ssbp1 T C 6: 40,478,021 (GRCm38) L138P probably damaging Het
Sv2a G A 3: 96,185,272 (GRCm38) G96E probably damaging Het
Tbc1d9 G T 8: 83,210,531 (GRCm38) G81C possibly damaging Het
Tmem67 G A 4: 12,040,640 (GRCm38) Q968* probably null Het
Tnni2 T C 7: 142,444,266 (GRCm38) S169P probably damaging Het
Tpk1 T C 6: 43,469,150 (GRCm38) probably null Het
Unc13b A T 4: 43,255,551 (GRCm38) E1057D probably damaging Het
Unc13b T A 4: 43,216,123 (GRCm38) Y141N possibly damaging Het
Usf3 G T 16: 44,221,573 (GRCm38) G2139C probably damaging Het
Vmn1r36 A T 6: 66,716,446 (GRCm38) Y148* probably null Het
Vmn2r42 A C 7: 8,194,759 (GRCm38) M287R probably damaging Het
Vmn2r60 A T 7: 42,194,908 (GRCm38) H565L probably damaging Het
Zfp518a G A 19: 40,912,781 (GRCm38) V385I probably benign Het
Zfp974 A T 7: 27,912,051 (GRCm38) M83K probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,851,467 (GRCm38) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49,939,553 (GRCm38) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49,917,668 (GRCm38) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49,912,725 (GRCm38) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49,912,751 (GRCm38) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,857,334 (GRCm38) missense probably benign
IGL01475:Dmxl1 APN 18 49,871,714 (GRCm38) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49,920,938 (GRCm38) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49,962,205 (GRCm38) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,863,025 (GRCm38) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,864,868 (GRCm38) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49,878,382 (GRCm38) nonsense probably null
IGL01933:Dmxl1 APN 18 49,877,785 (GRCm38) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49,890,654 (GRCm38) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49,894,178 (GRCm38) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49,961,163 (GRCm38) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49,877,674 (GRCm38) splice site probably benign
IGL02261:Dmxl1 APN 18 49,840,499 (GRCm38) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,864,895 (GRCm38) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,859,120 (GRCm38) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49,878,180 (GRCm38) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49,920,893 (GRCm38) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,864,818 (GRCm38) missense probably benign
capture UTSW 18 49,962,261 (GRCm38) missense probably damaging 1.00
carnivora UTSW 18 49,864,383 (GRCm38) missense probably damaging 0.99
digestion UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
drowning UTSW 18 49,878,225 (GRCm38) missense possibly damaging 0.55
hibiscus UTSW 18 49,889,467 (GRCm38) missense probably damaging 1.00
impound UTSW 18 49,893,249 (GRCm38) missense probably benign
pitcher UTSW 18 49,864,148 (GRCm38) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 49,931,963 (GRCm38) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 49,888,897 (GRCm38) splice site probably benign
R0027:Dmxl1 UTSW 18 49,957,295 (GRCm38) splice site probably benign
R0042:Dmxl1 UTSW 18 49,864,035 (GRCm38) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,864,035 (GRCm38) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49,878,082 (GRCm38) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49,878,082 (GRCm38) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49,955,803 (GRCm38) splice site probably benign
R0349:Dmxl1 UTSW 18 49,879,282 (GRCm38) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49,879,362 (GRCm38) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49,891,467 (GRCm38) nonsense probably null
R0539:Dmxl1 UTSW 18 49,857,430 (GRCm38) splice site probably benign
R0542:Dmxl1 UTSW 18 49,893,694 (GRCm38) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49,935,307 (GRCm38) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,851,423 (GRCm38) splice site probably benign
R0744:Dmxl1 UTSW 18 49,833,148 (GRCm38) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,833,148 (GRCm38) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49,893,402 (GRCm38) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49,893,611 (GRCm38) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49,893,225 (GRCm38) missense probably benign
R1313:Dmxl1 UTSW 18 49,878,483 (GRCm38) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49,878,483 (GRCm38) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49,888,853 (GRCm38) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,857,249 (GRCm38) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,852,367 (GRCm38) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,859,286 (GRCm38) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49,890,767 (GRCm38) nonsense probably null
R1646:Dmxl1 UTSW 18 49,962,261 (GRCm38) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49,934,637 (GRCm38) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49,902,988 (GRCm38) missense probably benign
R1732:Dmxl1 UTSW 18 49,893,444 (GRCm38) nonsense probably null
R1886:Dmxl1 UTSW 18 49,859,135 (GRCm38) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,859,135 (GRCm38) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49,955,914 (GRCm38) splice site probably null
R1911:Dmxl1 UTSW 18 49,878,163 (GRCm38) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49,889,558 (GRCm38) nonsense probably null
R2116:Dmxl1 UTSW 18 49,878,817 (GRCm38) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49,917,631 (GRCm38) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49,894,094 (GRCm38) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49,893,923 (GRCm38) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,846,639 (GRCm38) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49,919,976 (GRCm38) splice site probably null
R2343:Dmxl1 UTSW 18 49,890,678 (GRCm38) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49,880,791 (GRCm38) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49,935,317 (GRCm38) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49,935,317 (GRCm38) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,865,122 (GRCm38) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,865,122 (GRCm38) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,865,122 (GRCm38) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49,878,259 (GRCm38) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,863,962 (GRCm38) missense probably benign
R4033:Dmxl1 UTSW 18 49,851,431 (GRCm38) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49,961,197 (GRCm38) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49,878,017 (GRCm38) nonsense probably null
R4406:Dmxl1 UTSW 18 49,889,553 (GRCm38) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,848,761 (GRCm38) missense probably benign
R4454:Dmxl1 UTSW 18 49,893,332 (GRCm38) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49,961,216 (GRCm38) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,852,360 (GRCm38) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,852,360 (GRCm38) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49,962,181 (GRCm38) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49,878,631 (GRCm38) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49,878,021 (GRCm38) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,862,992 (GRCm38) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,851,476 (GRCm38) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49,889,467 (GRCm38) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49,957,281 (GRCm38) intron probably benign
R4885:Dmxl1 UTSW 18 49,878,795 (GRCm38) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49,877,697 (GRCm38) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49,895,127 (GRCm38) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49,870,923 (GRCm38) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49,893,584 (GRCm38) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49,951,235 (GRCm38) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,863,119 (GRCm38) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49,867,899 (GRCm38) splice site probably null
R5484:Dmxl1 UTSW 18 49,889,464 (GRCm38) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,864,478 (GRCm38) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49,877,697 (GRCm38) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49,891,626 (GRCm38) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49,894,257 (GRCm38) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49,931,941 (GRCm38) nonsense probably null
R5706:Dmxl1 UTSW 18 49,957,395 (GRCm38) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,846,586 (GRCm38) missense probably benign
R5876:Dmxl1 UTSW 18 49,870,984 (GRCm38) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,857,386 (GRCm38) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49,912,766 (GRCm38) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49,893,335 (GRCm38) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,863,015 (GRCm38) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49,902,367 (GRCm38) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49,871,732 (GRCm38) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,846,586 (GRCm38) missense probably benign
R6319:Dmxl1 UTSW 18 49,852,300 (GRCm38) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,864,578 (GRCm38) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,859,179 (GRCm38) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49,878,246 (GRCm38) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49,880,780 (GRCm38) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49,893,974 (GRCm38) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49,921,024 (GRCm38) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49,955,823 (GRCm38) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49,955,823 (GRCm38) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,852,288 (GRCm38) nonsense probably null
R6857:Dmxl1 UTSW 18 49,864,835 (GRCm38) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49,935,305 (GRCm38) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,843,784 (GRCm38) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49,920,902 (GRCm38) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,863,057 (GRCm38) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,851,495 (GRCm38) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,864,148 (GRCm38) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 49,955,853 (GRCm38) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,864,614 (GRCm38) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 49,878,612 (GRCm38) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 49,893,957 (GRCm38) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 49,902,794 (GRCm38) missense probably benign
R7629:Dmxl1 UTSW 18 49,859,270 (GRCm38) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 49,893,552 (GRCm38) missense probably benign
R7688:Dmxl1 UTSW 18 49,955,871 (GRCm38) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,846,618 (GRCm38) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 49,893,461 (GRCm38) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 49,878,315 (GRCm38) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 49,920,977 (GRCm38) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,840,490 (GRCm38) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 49,961,147 (GRCm38) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,864,383 (GRCm38) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 49,893,407 (GRCm38) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 49,878,433 (GRCm38) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 49,888,830 (GRCm38) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,843,811 (GRCm38) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 49,898,714 (GRCm38) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 49,878,342 (GRCm38) missense probably benign
R8402:Dmxl1 UTSW 18 49,878,326 (GRCm38) nonsense probably null
R8402:Dmxl1 UTSW 18 49,878,327 (GRCm38) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,865,116 (GRCm38) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 49,871,692 (GRCm38) nonsense probably null
R8702:Dmxl1 UTSW 18 49,859,135 (GRCm38) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 49,955,870 (GRCm38) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 49,957,339 (GRCm38) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 49,878,225 (GRCm38) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,893,674 (GRCm38) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,864,508 (GRCm38) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 49,922,612 (GRCm38) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 49,893,852 (GRCm38) missense
R9011:Dmxl1 UTSW 18 49,864,173 (GRCm38) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 49,939,572 (GRCm38) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 49,878,925 (GRCm38) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 49,893,249 (GRCm38) missense probably benign
R9254:Dmxl1 UTSW 18 49,891,500 (GRCm38) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,843,852 (GRCm38) missense probably benign 0.03
R9375:Dmxl1 UTSW 18 49,958,410 (GRCm38) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 49,891,500 (GRCm38) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 49,877,721 (GRCm38) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 49,893,710 (GRCm38) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 49,878,204 (GRCm38) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 49,891,500 (GRCm38) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,865,161 (GRCm38) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 49,880,758 (GRCm38) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 49,893,394 (GRCm38) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,864,368 (GRCm38) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49,919,899 (GRCm38) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49,920,965 (GRCm38) missense probably benign
Z1188:Dmxl1 UTSW 18 49,868,003 (GRCm38) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 49,868,003 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTGGGCAAAGACATCAAGC -3'
(R):5'- TCACAGGTACCTATCCAGATGG -3'

Sequencing Primer
(F):5'- GCCTTATTGTATAGACCAGGCTAGC -3'
(R):5'- CACAGGTACCTATCCAGATGGTATGG -3'
Posted On 2022-04-18