Incidental Mutation 'R9336:Pbx3'
ID 707118
Institutional Source Beutler Lab
Gene Symbol Pbx3
Ensembl Gene ENSMUSG00000038718
Gene Name pre B cell leukemia homeobox 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 34171457-34373142 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34371820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 34 (H34L)
Ref Sequence ENSEMBL: ENSMUSP00000045281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040638] [ENSMUST00000113132] [ENSMUST00000127353] [ENSMUST00000138021] [ENSMUST00000141653] [ENSMUST00000143776] [ENSMUST00000153278]
AlphaFold O35317
Predicted Effect probably benign
Transcript: ENSMUST00000040638
AA Change: H34L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045281
Gene: ENSMUSG00000038718
AA Change: H34L

DomainStartEndE-ValueType
Pfam:PBC 43 234 2.7e-97 PFAM
HOX 235 300 1.74e-17 SMART
low complexity region 308 341 N/A INTRINSIC
Blast:HOX 342 385 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113132
AA Change: H34L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108757
Gene: ENSMUSG00000038718
AA Change: H34L

DomainStartEndE-ValueType
Pfam:PBC 38 234 8.5e-103 PFAM
HOX 235 300 8.8e-20 SMART
low complexity region 308 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127353
SMART Domains Protein: ENSMUSP00000114695
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 1 54 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138021
SMART Domains Protein: ENSMUSP00000135226
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 3 128 3.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141653
SMART Domains Protein: ENSMUSP00000115710
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 1 96 6.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143776
AA Change: H34L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119914
Gene: ENSMUSG00000038718
AA Change: H34L

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153278
AA Change: H34L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123567
Gene: ENSMUSG00000038718
AA Change: H34L

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175855
SMART Domains Protein: ENSMUSP00000135838
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 1 53 1.6e-27 PFAM
HOX 54 119 8.8e-20 SMART
low complexity region 127 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality with hypoventilation and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dsg3 C A 18: 20,524,685 Q271K probably benign Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Erbb3 T C 10: 128,585,060 T125A probably benign Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Kmt2d A C 15: 98,845,816 L3821R unknown Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pik3c2g G T 6: 139,875,435 Q687H Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tas2r126 T C 6: 42,434,943 S137P probably benign Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Vmn2r120 T A 17: 57,525,201 D196V possibly damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Pbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02468:Pbx3 APN 2 34224577 missense probably damaging 1.00
IGL02524:Pbx3 APN 2 34370818 splice site probably benign
PIT4812001:Pbx3 UTSW 2 34224619 missense probably damaging 0.96
R0302:Pbx3 UTSW 2 34224560 missense probably benign 0.42
R1526:Pbx3 UTSW 2 34371764 missense probably damaging 1.00
R1529:Pbx3 UTSW 2 34204859 missense probably damaging 1.00
R1627:Pbx3 UTSW 2 34175953 missense probably benign 0.00
R1652:Pbx3 UTSW 2 34224556 missense probably damaging 1.00
R1791:Pbx3 UTSW 2 34224452 missense possibly damaging 0.95
R1850:Pbx3 UTSW 2 34176820 missense probably benign 0.34
R2908:Pbx3 UTSW 2 34172921 missense probably damaging 0.96
R4073:Pbx3 UTSW 2 34224412 missense probably damaging 1.00
R5212:Pbx3 UTSW 2 34288781 intron probably benign
R5897:Pbx3 UTSW 2 34371908 missense probably benign 0.01
R7376:Pbx3 UTSW 2 34204877 missense probably damaging 0.96
R7504:Pbx3 UTSW 2 34175924 missense probably damaging 0.99
R7812:Pbx3 UTSW 2 34224466 missense probably damaging 1.00
R8079:Pbx3 UTSW 2 34178228 missense probably benign 0.36
R9104:Pbx3 UTSW 2 34224617 missense probably damaging 1.00
R9114:Pbx3 UTSW 2 34213259 missense probably damaging 1.00
R9225:Pbx3 UTSW 2 34370926 unclassified probably benign
R9420:Pbx3 UTSW 2 34213336 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCGAGTTTGTCCCGAGCC -3'
(R):5'- CTGAGGACCAAGTTGTGCGG -3'

Sequencing Primer
(F):5'- AACTTTGCCCGCGCGATG -3'
(R):5'- CGCCGCTGTCCTCAGTC -3'
Posted On 2022-04-18