Incidental Mutation 'R0742:Steap3'
List |< first << previous [record 25 of 33] next >> last >|
ID70714
Institutional Source Beutler Lab
Gene Symbol Steap3
Ensembl Gene ENSMUSG00000026389
Gene NameSTEAP family member 3
SynonymspHyde, 1010001D01Rik
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location120190757-120272705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120241583 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 328 (R328H)
Ref Sequence ENSEMBL: ENSMUSP00000108262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112639] [ENSMUST00000112640] [ENSMUST00000112641] [ENSMUST00000112643] [ENSMUST00000140490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112639
AA Change: R290H

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108258
Gene: ENSMUSG00000026389
AA Change: R290H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112640
AA Change: R290H

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108259
Gene: ENSMUSG00000026389
AA Change: R290H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112641
AA Change: R290H

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108260
Gene: ENSMUSG00000026389
AA Change: R290H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 5.7e-19 PFAM
Pfam:Ferric_reduct 259 407 1.2e-19 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112643
AA Change: R328H

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108262
Gene: ENSMUSG00000026389
AA Change: R328H

DomainStartEndE-ValueType
Pfam:F420_oxidored 68 155 7.3e-19 PFAM
Pfam:Ferric_reduct 297 445 7.9e-15 PFAM
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140490
AA Change: R290H

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121046
Gene: ENSMUSG00000026389
AA Change: R290H

DomainStartEndE-ValueType
Pfam:F420_oxidored 30 117 1.6e-18 PFAM
Pfam:Ferric_reduct 259 406 3.6e-20 PFAM
Meta Mutation Damage Score 0.1778 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass membrane protein that functions as an iron transporter. The encoded protein can reduce both iron (Fe3+) and copper (Cu2+) cations. This protein may mediate downstream responses to p53, including promoting apoptosis. Deficiency in this gene can cause anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous inactivation of this gene results in microcytic anemia, increased erythrocyte cell number, abnormal reticulocyte morphology, anisopoikilocytosis, decreased mean corpuscular hemoglobin, decreased mean corpuscular volume, and thrombocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Steap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Steap3 APN 1 120241574 missense probably benign 0.02
IGL02307:Steap3 APN 1 120241660 nonsense probably null
IGL02413:Steap3 APN 1 120241772 missense probably damaging 0.99
IGL03237:Steap3 APN 1 120243790 missense probably damaging 1.00
R0076:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R0157:Steap3 UTSW 1 120227649 makesense probably null
R0468:Steap3 UTSW 1 120234300 missense probably damaging 1.00
R0507:Steap3 UTSW 1 120241583 missense possibly damaging 0.78
R0727:Steap3 UTSW 1 120227817 missense possibly damaging 0.91
R1439:Steap3 UTSW 1 120227820 missense probably damaging 1.00
R1728:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1728:Steap3 UTSW 1 120234378 missense probably benign
R1729:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1729:Steap3 UTSW 1 120234378 missense probably benign
R1730:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1730:Steap3 UTSW 1 120234378 missense probably benign
R1739:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1739:Steap3 UTSW 1 120234378 missense probably benign
R1762:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1762:Steap3 UTSW 1 120234378 missense probably benign
R1783:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1783:Steap3 UTSW 1 120234378 missense probably benign
R1785:Steap3 UTSW 1 120227750 missense probably benign 0.00
R1785:Steap3 UTSW 1 120234378 missense probably benign
R1902:Steap3 UTSW 1 120241734 missense probably benign
R3827:Steap3 UTSW 1 120227730 missense probably damaging 1.00
R4574:Steap3 UTSW 1 120241456 missense probably benign 0.00
R4805:Steap3 UTSW 1 120243886 missense probably benign 0.04
R5176:Steap3 UTSW 1 120243767 critical splice donor site probably null
R5285:Steap3 UTSW 1 120241880 missense probably damaging 0.98
R5481:Steap3 UTSW 1 120241724 missense probably benign
R5906:Steap3 UTSW 1 120244001 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6038:Steap3 UTSW 1 120241641 missense probably damaging 1.00
R6922:Steap3 UTSW 1 120243894 missense probably damaging 1.00
R7258:Steap3 UTSW 1 120243986 missense possibly damaging 0.73
R7278:Steap3 UTSW 1 120234357 missense probably damaging 0.97
R7315:Steap3 UTSW 1 120227912 missense probably benign 0.01
R7439:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7440:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7441:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7444:Steap3 UTSW 1 120241518 missense probably benign 0.31
R7452:Steap3 UTSW 1 120227855 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACCTGCTTCACAGCCAGATTGACC -3'
(R):5'- TGCAGTGATCAGCCAGAAGCCAAG -3'

Sequencing Primer
(F):5'- CCAGATTGACCAGGTCGTAG -3'
(R):5'- ATCTCAGAGATGGCACGC -3'
Posted On2013-09-30