Incidental Mutation 'R9336:Tas2r126'
ID 707147
Institutional Source Beutler Lab
Gene Symbol Tas2r126
Ensembl Gene ENSMUSG00000048284
Gene Name taste receptor, type 2, member 126
Synonyms T2R12, mt2r35, T2R26, mGR26, Tas2r26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42434535-42435464 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42434943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 137 (S137P)
Ref Sequence ENSEMBL: ENSMUSP00000056581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059534]
AlphaFold P59532
Predicted Effect probably benign
Transcript: ENSMUST00000059534
AA Change: S137P

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056581
Gene: ENSMUSG00000048284
AA Change: S137P

DomainStartEndE-ValueType
Pfam:TAS2R 1 303 2.5e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dsg3 C A 18: 20,524,685 Q271K probably benign Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Erbb3 T C 10: 128,585,060 T125A probably benign Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Kmt2d A C 15: 98,845,816 L3821R unknown Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pbx3 T A 2: 34,371,820 H34L probably benign Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pik3c2g G T 6: 139,875,435 Q687H Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Vmn2r120 T A 17: 57,525,201 D196V possibly damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Tas2r126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Tas2r126 APN 6 42435349 missense possibly damaging 0.67
IGL01327:Tas2r126 APN 6 42434750 missense probably benign 0.09
IGL01690:Tas2r126 APN 6 42435307 missense probably benign 0.02
IGL02153:Tas2r126 APN 6 42434664 missense probably benign 0.32
IGL02291:Tas2r126 APN 6 42435287 missense probably benign 0.00
IGL03365:Tas2r126 APN 6 42435457 missense probably benign 0.36
R0091:Tas2r126 UTSW 6 42435102 missense probably benign
R0486:Tas2r126 UTSW 6 42435291 missense probably benign 0.01
R0611:Tas2r126 UTSW 6 42435091 missense probably damaging 0.99
R1527:Tas2r126 UTSW 6 42435136 missense probably benign 0.03
R1529:Tas2r126 UTSW 6 42434568 missense probably benign 0.00
R1883:Tas2r126 UTSW 6 42435027 missense probably benign
R1884:Tas2r126 UTSW 6 42435027 missense probably benign
R2039:Tas2r126 UTSW 6 42434623 missense probably benign 0.22
R4863:Tas2r126 UTSW 6 42435390 missense probably benign 0.02
R5975:Tas2r126 UTSW 6 42435000 missense possibly damaging 0.69
R7127:Tas2r126 UTSW 6 42434805 missense probably damaging 1.00
R7351:Tas2r126 UTSW 6 42435306 missense probably benign 0.02
R7714:Tas2r126 UTSW 6 42435097 missense probably benign 0.12
R9154:Tas2r126 UTSW 6 42435240 missense probably benign 0.25
R9516:Tas2r126 UTSW 6 42435373 missense probably null 0.98
Predicted Primers PCR Primer
(F):5'- CCGGCAGCTCATTAGTCTTC -3'
(R):5'- ATTCTTAGCGAATGCCTTCTGAG -3'

Sequencing Primer
(F):5'- CACTGGGACTTCTTGAACTCAG -3'
(R):5'- CGAATGCCTTCTGAGAGAACTGATC -3'
Posted On 2022-04-18