Incidental Mutation 'R9336:Pik3c2g'
ID 707150
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 139587221-139969284 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 139875435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 687 (Q687H)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087657
AA Change: Q319H

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: Q319H

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: Q687H

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dsg3 C A 18: 20,524,685 Q271K probably benign Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Erbb3 T C 10: 128,585,060 T125A probably benign Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Kmt2d A C 15: 98,845,816 L3821R unknown Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pbx3 T A 2: 34,371,820 H34L probably benign Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tas2r126 T C 6: 42,434,943 S137P probably benign Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Vmn2r120 T A 17: 57,525,201 D196V possibly damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 splice site probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R7923:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139882060 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139936056 missense unknown
R8724:Pik3c2g UTSW 6 139967893 missense unknown
R8733:Pik3c2g UTSW 6 139768700 nonsense probably null
R8809:Pik3c2g UTSW 6 139768710 missense
R8888:Pik3c2g UTSW 6 139730366 nonsense probably null
R8931:Pik3c2g UTSW 6 139875367 missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139622403 missense possibly damaging 0.94
R9383:Pik3c2g UTSW 6 139882016 nonsense probably null
R9524:Pik3c2g UTSW 6 139629770 missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139896200 missense
R9630:Pik3c2g UTSW 6 139622239 missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139967791 missense unknown
R9708:Pik3c2g UTSW 6 139629867 missense probably benign
R9717:Pik3c2g UTSW 6 139896184 missense
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTCCTCATGGTTGTTGC -3'
(R):5'- CCCCTCTGAATGCACTAGTAAC -3'

Sequencing Primer
(F):5'- TTTATAGGGACAGAGCCCC -3'
(R):5'- CTCTGAATGCACTAGTAACTCTGTG -3'
Posted On 2022-04-18