Incidental Mutation 'R9336:Tenm3'
ID 707159
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Odz3, Ten-m3, 2610100B16Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 48680717-49296986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48870115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 226 (L226Q)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: L226Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: L226Q

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110343
SMART Domains Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110345
SMART Domains Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110346
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190840
AA Change: L226Q
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: L226Q

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211976
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 148,029,490 (GRCm39) R487C probably benign Het
2900026A02Rik A T 5: 113,240,966 (GRCm39) probably null Het
Adamts15 T A 9: 30,816,085 (GRCm39) T625S probably damaging Het
Adamtsl1 T C 4: 86,240,264 (GRCm39) V675A probably benign Het
Ank3 A T 10: 69,809,578 (GRCm39) T1120S probably benign Het
Armh3 A T 19: 45,945,120 (GRCm39) M277K probably damaging Het
Babam2 A T 5: 31,859,194 (GRCm39) M1L possibly damaging Het
Cadm3 G A 1: 173,168,786 (GRCm39) Q261* probably null Het
Cdc27 A T 11: 104,396,496 (GRCm39) D802E probably benign Het
Cfap206 C T 4: 34,716,494 (GRCm39) V324I probably benign Het
Cfap44 T C 16: 44,242,807 (GRCm39) I737T probably damaging Het
Chrm3 A T 13: 9,928,652 (GRCm39) I128N probably damaging Het
Cyfip1 T A 7: 55,554,189 (GRCm39) S743T probably benign Het
Ddias A G 7: 92,507,314 (GRCm39) V867A possibly damaging Het
Ddx20 G C 3: 105,585,903 (GRCm39) T814R possibly damaging Het
Dgka A T 10: 128,566,935 (GRCm39) probably null Het
Dnah9 A T 11: 65,761,775 (GRCm39) V3905E probably damaging Het
Dsg3 C A 18: 20,657,742 (GRCm39) Q271K probably benign Het
Dvl2 T A 11: 69,897,180 (GRCm39) I294N probably damaging Het
E2f3 G A 13: 30,095,239 (GRCm39) H350Y possibly damaging Het
Eif2b5 G A 16: 20,324,027 (GRCm39) D457N probably damaging Het
Erbb3 T C 10: 128,420,929 (GRCm39) T125A probably benign Het
Etv5 A C 16: 22,254,627 (GRCm39) C78G probably benign Het
Frrs1 G A 3: 116,684,582 (GRCm39) R263H probably benign Het
Grid1 G A 14: 35,043,664 (GRCm39) D340N probably damaging Het
Hivep3 A T 4: 119,952,400 (GRCm39) I239F possibly damaging Het
Ifi208 C T 1: 173,510,394 (GRCm39) T183I probably damaging Het
Ifitm2 AG A 7: 140,535,814 (GRCm39) probably null Het
Igkv1-88 T A 6: 68,839,313 (GRCm39) I100F probably damaging Het
Kmt2c T C 5: 25,614,165 (GRCm39) N185S probably benign Het
Kmt2d A C 15: 98,743,697 (GRCm39) L3821R unknown Het
Krtap22-2 T G 16: 88,807,478 (GRCm39) Y40S unknown Het
Lrrc1 A G 9: 77,349,480 (GRCm39) V362A probably damaging Het
Malsu1 T A 6: 49,061,449 (GRCm39) I171N probably damaging Het
Mark1 C T 1: 184,648,345 (GRCm39) G314S possibly damaging Het
Mib2 T C 4: 155,743,394 (GRCm39) N135S probably benign Het
Mos A T 4: 3,870,886 (GRCm39) L310Q probably damaging Het
Muc4 C T 16: 32,569,756 (GRCm39) T272I possibly damaging Het
Myo15b A G 11: 115,771,064 (GRCm39) T1654A Het
Napsa G T 7: 44,231,769 (GRCm39) G153W probably damaging Het
Nos3 A C 5: 24,584,761 (GRCm39) I722L probably benign Het
Or10z1 A T 1: 174,077,679 (GRCm39) D271E probably damaging Het
Or1p1c A T 11: 74,160,743 (GRCm39) D176V probably damaging Het
Or51h1 A T 7: 102,308,199 (GRCm39) H57L probably damaging Het
Or5b104 A T 19: 13,072,513 (GRCm39) S166R probably benign Het
P4ha2 T A 11: 54,002,390 (GRCm39) D109E possibly damaging Het
Pappa G T 4: 65,042,918 (GRCm39) C47F unknown Het
Pbx3 T A 2: 34,261,832 (GRCm39) H34L probably benign Het
Pcca A G 14: 122,887,738 (GRCm39) T234A probably benign Het
Pcdha11 C T 18: 37,144,514 (GRCm39) R202W probably damaging Het
Pcdhga1 T G 18: 37,795,251 (GRCm39) V85G probably damaging Het
Pclo A G 5: 14,726,562 (GRCm39) I1807V unknown Het
Pgm3 A T 9: 86,437,413 (GRCm39) F528Y probably benign Het
Pigz T C 16: 31,763,694 (GRCm39) Y251H probably damaging Het
Pik3c2g G T 6: 139,821,161 (GRCm39) Q687H Het
Pja2 A T 17: 64,590,432 (GRCm39) N700K unknown Het
Pkd2l2 T C 18: 34,561,158 (GRCm39) F389L probably damaging Het
Plcz1 T A 6: 139,985,446 (GRCm39) T32S possibly damaging Het
Pola2 A G 19: 5,991,029 (GRCm39) V555A possibly damaging Het
Ppp4r3a A C 12: 101,015,919 (GRCm39) C541G probably benign Het
Prr15l A T 11: 96,825,599 (GRCm39) K76N probably damaging Het
Psg28 C A 7: 18,156,905 (GRCm39) K443N possibly damaging Het
Ptch2 G T 4: 116,954,197 (GRCm39) A76S probably damaging Het
Ptch2 A G 4: 116,966,776 (GRCm39) D553G possibly damaging Het
Ptprz1 T C 6: 23,000,855 (GRCm39) S982P probably benign Het
Rnd3 T C 2: 51,038,844 (GRCm39) I15V probably benign Het
Rtn3 T C 19: 7,460,328 (GRCm39) K41E unknown Het
Sap25 T C 5: 137,639,985 (GRCm39) S30P probably benign Het
Scfd2 A T 5: 74,692,006 (GRCm39) I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 (GRCm39) Y106C probably damaging Het
Sell T C 1: 163,893,177 (GRCm39) I131T probably damaging Het
Sesn3 T A 9: 14,225,850 (GRCm39) V195D probably damaging Het
Setdb2 A G 14: 59,660,816 (GRCm39) V109A unknown Het
Skint2 T C 4: 112,483,054 (GRCm39) I153T probably benign Het
Slc22a1 A G 17: 12,886,142 (GRCm39) S164P probably damaging Het
Sowahc G A 10: 59,058,305 (GRCm39) G147D probably benign Het
Strip2 G C 6: 29,931,824 (GRCm39) G456R probably benign Het
Synpo G T 18: 60,735,472 (GRCm39) R825S probably damaging Het
Tango6 A G 8: 107,415,701 (GRCm39) D174G probably benign Het
Tas1r2 T C 4: 139,389,316 (GRCm39) F433S probably damaging Het
Tas2r126 T C 6: 42,411,877 (GRCm39) S137P probably benign Het
Tbc1d15 A G 10: 115,044,866 (GRCm39) F512S probably damaging Het
Tmod1 A G 4: 46,078,368 (GRCm39) T59A probably damaging Het
Tmprss9 T A 10: 80,730,787 (GRCm39) M771K probably benign Het
Trim29 T C 9: 43,238,350 (GRCm39) Y485H possibly damaging Het
Ttc17 T C 2: 94,189,198 (GRCm39) K144E probably benign Het
Ttc21b A G 2: 66,057,287 (GRCm39) Y562H probably benign Het
Ugt2b5 T C 5: 87,285,130 (GRCm39) H269R probably benign Het
Utp20 A G 10: 88,649,798 (GRCm39) F471L probably damaging Het
Vmn2r120 T A 17: 57,832,201 (GRCm39) D196V possibly damaging Het
Wdr72 T C 9: 74,117,292 (GRCm39) V680A probably damaging Het
Wee1 G A 7: 109,721,689 (GRCm39) G45S probably damaging Het
Zfp1006 A T 8: 129,944,149 (GRCm39) D91E unknown Het
Zfp518a G A 19: 40,901,225 (GRCm39) V385I probably benign Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,870,095 (GRCm39) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,689,060 (GRCm39) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,732,077 (GRCm39) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,729,456 (GRCm39) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,870,167 (GRCm39) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,709,876 (GRCm39) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,689,458 (GRCm39) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,729,680 (GRCm39) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,681,837 (GRCm39) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,707,512 (GRCm39) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,689,793 (GRCm39) nonsense probably null
IGL01892:Tenm3 APN 8 48,729,431 (GRCm39) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,729,611 (GRCm39) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,688,511 (GRCm39) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,689,729 (GRCm39) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,732,233 (GRCm39) splice site probably benign
IGL02502:Tenm3 APN 8 48,741,051 (GRCm39) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,752,674 (GRCm39) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,751,991 (GRCm39) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,729,938 (GRCm39) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,751,913 (GRCm39) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 49,099,453 (GRCm39) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,688,558 (GRCm39) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,688,381 (GRCm39) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,688,642 (GRCm39) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,746,692 (GRCm39) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,796,380 (GRCm39) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,795,694 (GRCm39) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,794,069 (GRCm39) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,689,947 (GRCm39) splice site probably benign
R0335:Tenm3 UTSW 8 48,685,140 (GRCm39) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,682,010 (GRCm39) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,740,826 (GRCm39) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,794,195 (GRCm39) splice site probably benign
R0573:Tenm3 UTSW 8 49,127,434 (GRCm39) splice site probably benign
R0599:Tenm3 UTSW 8 48,730,745 (GRCm39) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,729,191 (GRCm39) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,689,560 (GRCm39) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,689,629 (GRCm39) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,788,777 (GRCm39) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,752,000 (GRCm39) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,681,577 (GRCm39) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,688,617 (GRCm39) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,693,431 (GRCm39) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,740,928 (GRCm39) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,729,435 (GRCm39) missense probably benign
R1455:Tenm3 UTSW 8 48,732,083 (GRCm39) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,689,006 (GRCm39) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,763,660 (GRCm39) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,796,351 (GRCm39) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,740,857 (GRCm39) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,848,611 (GRCm39) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,682,016 (GRCm39) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,689,456 (GRCm39) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,682,028 (GRCm39) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,732,109 (GRCm39) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,870,154 (GRCm39) missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48,763,669 (GRCm39) missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48,685,139 (GRCm39) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,870,214 (GRCm39) missense probably benign 0.05
R1793:Tenm3 UTSW 8 49,127,579 (GRCm39) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,729,291 (GRCm39) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,729,381 (GRCm39) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,763,796 (GRCm39) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,689,348 (GRCm39) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,681,626 (GRCm39) missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48,681,703 (GRCm39) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,795,291 (GRCm39) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,796,384 (GRCm39) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,870,041 (GRCm39) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,848,579 (GRCm39) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 49,127,585 (GRCm39) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,795,372 (GRCm39) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,740,988 (GRCm39) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,693,305 (GRCm39) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,681,590 (GRCm39) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,730,781 (GRCm39) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,802,258 (GRCm39) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,802,439 (GRCm39) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,848,693 (GRCm39) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,746,761 (GRCm39) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,689,005 (GRCm39) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,763,656 (GRCm39) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,688,856 (GRCm39) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,729,896 (GRCm39) missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48,754,006 (GRCm39) missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48,731,996 (GRCm39) nonsense probably null
R4995:Tenm3 UTSW 8 48,682,172 (GRCm39) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,688,861 (GRCm39) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,795,343 (GRCm39) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,682,233 (GRCm39) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,689,890 (GRCm39) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,740,866 (GRCm39) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,689,599 (GRCm39) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,820,412 (GRCm39) nonsense probably null
R5566:Tenm3 UTSW 8 48,732,041 (GRCm39) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,689,799 (GRCm39) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,681,797 (GRCm39) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 49,099,533 (GRCm39) missense probably benign 0.00
R5959:Tenm3 UTSW 8 49,099,482 (GRCm39) nonsense probably null
R5965:Tenm3 UTSW 8 48,681,543 (GRCm39) nonsense probably null
R6062:Tenm3 UTSW 8 48,796,441 (GRCm39) missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48,848,608 (GRCm39) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,751,843 (GRCm39) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,707,657 (GRCm39) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,746,700 (GRCm39) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,870,094 (GRCm39) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,820,429 (GRCm39) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,729,884 (GRCm39) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,689,098 (GRCm39) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6516:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6747:Tenm3 UTSW 8 48,796,278 (GRCm39) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 49,099,291 (GRCm39) critical splice donor site probably null
R6788:Tenm3 UTSW 8 49,127,528 (GRCm39) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,709,872 (GRCm39) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,729,773 (GRCm39) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 49,127,451 (GRCm39) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,693,514 (GRCm39) nonsense probably null
R6968:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,693,479 (GRCm39) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 49,127,588 (GRCm39) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,745,271 (GRCm39) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,754,004 (GRCm39) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,688,970 (GRCm39) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,689,212 (GRCm39) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,689,218 (GRCm39) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,740,847 (GRCm39) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,729,635 (GRCm39) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,794,084 (GRCm39) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,788,762 (GRCm39) missense probably benign 0.27
R7734:Tenm3 UTSW 8 49,099,368 (GRCm39) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,689,500 (GRCm39) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,729,335 (GRCm39) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,682,146 (GRCm39) nonsense probably null
R7951:Tenm3 UTSW 8 48,763,738 (GRCm39) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,820,457 (GRCm39) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,746,808 (GRCm39) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,740,883 (GRCm39) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,746,544 (GRCm39) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,682,216 (GRCm39) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,795,668 (GRCm39) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,752,680 (GRCm39) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,802,391 (GRCm39) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,795,484 (GRCm39) frame shift probably null
R8820:Tenm3 UTSW 8 48,763,759 (GRCm39) missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8831:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8853:Tenm3 UTSW 8 48,795,382 (GRCm39) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,689,437 (GRCm39) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,688,637 (GRCm39) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,732,095 (GRCm39) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,688,383 (GRCm39) nonsense probably null
R8998:Tenm3 UTSW 8 48,729,722 (GRCm39) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,795,688 (GRCm39) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,707,668 (GRCm39) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,745,186 (GRCm39) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,788,548 (GRCm39) missense unknown
R9231:Tenm3 UTSW 8 48,689,231 (GRCm39) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 49,008,935 (GRCm39) unclassified probably benign
R9373:Tenm3 UTSW 8 48,752,690 (GRCm39) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 49,127,559 (GRCm39) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,766,292 (GRCm39) nonsense probably null
R9575:Tenm3 UTSW 8 48,688,796 (GRCm39) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,689,246 (GRCm39) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,753,849 (GRCm39) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,788,596 (GRCm39) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,740,864 (GRCm39) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,689,512 (GRCm39) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,729,815 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAAATGTGCCCCGTTG -3'
(R):5'- GCTCTGCAAGAAAAGTGGC -3'

Sequencing Primer
(F):5'- CGTTGTAAATCGTAGCAGCC -3'
(R):5'- CTCTGCAAGAAAAGTGGCAGTGC -3'
Posted On 2022-04-18