Incidental Mutation 'R0742:Mroh3'
ID70716
Institutional Source Beutler Lab
Gene Symbol Mroh3
Ensembl Gene ENSMUSG00000087230
Gene Namemaestro heat-like repeat family member 3
Synonyms
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136181652-136212828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136190980 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 533 (I533N)
Ref Sequence ENSEMBL: ENSMUSP00000148632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168561] [ENSMUST00000212798]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166708
Predicted Effect probably benign
Transcript: ENSMUST00000168561
SMART Domains Protein: ENSMUSP00000130772
Gene: ENSMUSG00000087230

DomainStartEndE-ValueType
SCOP:d1gw5a_ 126 669 2e-7 SMART
low complexity region 677 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
Predicted Effect probably damaging
Transcript: ENSMUST00000212798
AA Change: I533N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Mroh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Mroh3 UTSW 1 136190803 missense probably benign 0.00
R0507:Mroh3 UTSW 1 136190980 missense probably damaging 1.00
R0638:Mroh3 UTSW 1 136191002 missense probably damaging 1.00
R1728:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1729:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1730:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1739:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1762:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1783:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1784:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1785:Mroh3 UTSW 1 136192144 missense possibly damaging 0.80
R1862:Mroh3 UTSW 1 136185988 missense probably benign 0.01
R1883:Mroh3 UTSW 1 136206993 missense probably damaging 1.00
R2166:Mroh3 UTSW 1 136186053 missense probably benign 0.03
R2566:Mroh3 UTSW 1 136198126 missense probably damaging 1.00
R3713:Mroh3 UTSW 1 136185976 missense probably benign 0.01
R3788:Mroh3 UTSW 1 136185475 missense probably damaging 1.00
R4672:Mroh3 UTSW 1 136190975 missense probably benign 0.09
R4747:Mroh3 UTSW 1 136185499 missense probably benign 0.00
R4855:Mroh3 UTSW 1 136200939 critical splice donor site probably null
R5171:Mroh3 UTSW 1 136191656 missense possibly damaging 0.82
R5296:Mroh3 UTSW 1 136196323 missense probably damaging 0.98
R5869:Mroh3 UTSW 1 136186123 missense probably benign
R6347:Mroh3 UTSW 1 136200937 splice site probably null
R6531:Mroh3 UTSW 1 136184353 missense probably benign 0.01
R6675:Mroh3 UTSW 1 136190812 missense possibly damaging 0.65
R7015:Mroh3 UTSW 1 136183331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCAGCAGTTCTTGATGACC -3'
(R):5'- AGAGACCCTCATAACCCTTGTCCG -3'

Sequencing Primer
(F):5'- CAGTTCTTGATGACCAGAGATCTGAG -3'
(R):5'- CCTTGTCCGATTCAACTGTGAAATG -3'
Posted On2013-09-30