Incidental Mutation 'R9336:Kmt2d'
ID 707188
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll2, C430014K11Rik, Mll4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9336 (G1)
Quality Score 189.009
Status Not validated
Chromosome 15
Chromosomal Location 98831669-98871204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 98845816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 3821 (L3821R)
Ref Sequence ENSEMBL: ENSMUSP00000023741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: L3821R
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: L3821R

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: L3821R
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: L3821R

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dsg3 C A 18: 20,524,685 Q271K probably benign Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Erbb3 T C 10: 128,585,060 T125A probably benign Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pbx3 T A 2: 34,371,820 H34L probably benign Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pik3c2g G T 6: 139,875,435 Q687H Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tas2r126 T C 6: 42,434,943 S137P probably benign Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Vmn2r120 T A 17: 57,525,201 D196V possibly damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98862333 missense unknown
IGL00927:Kmt2d APN 15 98845009 unclassified probably benign
IGL01123:Kmt2d APN 15 98837148 missense unknown
IGL01288:Kmt2d APN 15 98865044 missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98860657 unclassified probably benign
IGL01575:Kmt2d APN 15 98846855 utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98856369 unclassified probably benign
IGL01750:Kmt2d APN 15 98853168 unclassified probably benign
IGL02163:Kmt2d APN 15 98835228 unclassified probably benign
IGL02209:Kmt2d APN 15 98854567 unclassified probably benign
IGL02253:Kmt2d APN 15 98858175 unclassified probably benign
IGL02271:Kmt2d APN 15 98866428 missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98865492 splice site probably benign
IGL02448:Kmt2d APN 15 98844110 unclassified probably benign
IGL02472:Kmt2d APN 15 98850077 missense probably benign 0.23
IGL02496:Kmt2d APN 15 98857558 unclassified probably benign
IGL02527:Kmt2d APN 15 98841747 unclassified probably benign
IGL02576:Kmt2d APN 15 98864120 missense unknown
IGL02597:Kmt2d APN 15 98863831 missense unknown
IGL02609:Kmt2d APN 15 98851793 unclassified probably benign
IGL03085:Kmt2d APN 15 98839940 unclassified probably benign
IGL03102:Kmt2d APN 15 98855543 missense probably benign
IGL03123:Kmt2d APN 15 98861771 missense unknown
G1citation:Kmt2d UTSW 15 98849459 unclassified probably benign
R0091:Kmt2d UTSW 15 98844479 unclassified probably benign
R0136:Kmt2d UTSW 15 98854278 unclassified probably benign
R0243:Kmt2d UTSW 15 98850137 unclassified probably benign
R0276:Kmt2d UTSW 15 98850311 unclassified probably benign
R0477:Kmt2d UTSW 15 98853581 unclassified probably benign
R0478:Kmt2d UTSW 15 98853581 unclassified probably benign
R0586:Kmt2d UTSW 15 98835207 unclassified probably benign
R0632:Kmt2d UTSW 15 98853581 unclassified probably benign
R0678:Kmt2d UTSW 15 98850413 unclassified probably benign
R0780:Kmt2d UTSW 15 98862857 missense unknown
R0891:Kmt2d UTSW 15 98852691 unclassified probably benign
R1136:Kmt2d UTSW 15 98857765 unclassified probably benign
R1417:Kmt2d UTSW 15 98866430 missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98844938 unclassified probably benign
R1510:Kmt2d UTSW 15 98856377 unclassified probably benign
R1586:Kmt2d UTSW 15 98865053 splice site probably benign
R1640:Kmt2d UTSW 15 98845057 unclassified probably benign
R1714:Kmt2d UTSW 15 98862950 missense unknown
R1725:Kmt2d UTSW 15 98845234 unclassified probably benign
R1728:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98845234 unclassified probably benign
R1744:Kmt2d UTSW 15 98865047 missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98864378 missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98843482 unclassified probably benign
R1782:Kmt2d UTSW 15 98857548 unclassified probably benign
R1789:Kmt2d UTSW 15 98852074 unclassified probably benign
R1802:Kmt2d UTSW 15 98862985 missense unknown
R1808:Kmt2d UTSW 15 98866686 missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98861780 missense unknown
R1831:Kmt2d UTSW 15 98855343 missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98855590 missense probably damaging 0.96
R1920:Kmt2d UTSW 15 98855591 missense probably damaging 1.00
R1956:Kmt2d UTSW 15 98859590 unclassified probably benign
R2100:Kmt2d UTSW 15 98846480 unclassified probably benign
R2120:Kmt2d UTSW 15 98839529 unclassified probably benign
R2188:Kmt2d UTSW 15 98839300 unclassified probably benign
R2191:Kmt2d UTSW 15 98861049 critical splice donor site probably null
R2234:Kmt2d UTSW 15 98865248 missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98862266 missense unknown
R2762:Kmt2d UTSW 15 98852055 unclassified probably benign
R2895:Kmt2d UTSW 15 98843939 unclassified probably benign
R3624:Kmt2d UTSW 15 98842902 unclassified probably benign
R3791:Kmt2d UTSW 15 98844149 unclassified probably benign
R3794:Kmt2d UTSW 15 98837359 unclassified probably benign
R3871:Kmt2d UTSW 15 98851021 unclassified probably benign
R3958:Kmt2d UTSW 15 98855549 missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98846046 unclassified probably benign
R4211:Kmt2d UTSW 15 98840189 unclassified probably benign
R4212:Kmt2d UTSW 15 98845003 unclassified probably benign
R4240:Kmt2d UTSW 15 98844571 unclassified probably benign
R4246:Kmt2d UTSW 15 98840089 unclassified probably benign
R4361:Kmt2d UTSW 15 98863670 missense unknown
R4388:Kmt2d UTSW 15 98853626 unclassified probably benign
R4602:Kmt2d UTSW 15 98850259 unclassified probably benign
R4606:Kmt2d UTSW 15 98839716 unclassified probably benign
R4658:Kmt2d UTSW 15 98852529 unclassified probably benign
R4840:Kmt2d UTSW 15 98861894 missense unknown
R4895:Kmt2d UTSW 15 98844487 unclassified probably benign
R4906:Kmt2d UTSW 15 98849539 unclassified probably benign
R4976:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98856162 missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98840224 unclassified probably benign
R5260:Kmt2d UTSW 15 98842860 unclassified probably benign
R5274:Kmt2d UTSW 15 98854230 unclassified probably benign
R5450:Kmt2d UTSW 15 98855086 missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98852109 unclassified probably benign
R5462:Kmt2d UTSW 15 98852109 unclassified probably benign
R5463:Kmt2d UTSW 15 98852109 unclassified probably benign
R5465:Kmt2d UTSW 15 98852109 unclassified probably benign
R5467:Kmt2d UTSW 15 98852109 unclassified probably benign
R5481:Kmt2d UTSW 15 98862005 missense unknown
R5509:Kmt2d UTSW 15 98839676 unclassified probably benign
R5534:Kmt2d UTSW 15 98837357 unclassified probably benign
R5536:Kmt2d UTSW 15 98852109 unclassified probably benign
R5537:Kmt2d UTSW 15 98852109 unclassified probably benign
R5538:Kmt2d UTSW 15 98852109 unclassified probably benign
R5546:Kmt2d UTSW 15 98853068 unclassified probably benign
R5595:Kmt2d UTSW 15 98850024 unclassified probably benign
R5645:Kmt2d UTSW 15 98844397 unclassified probably benign
R5679:Kmt2d UTSW 15 98854272 unclassified probably benign
R5710:Kmt2d UTSW 15 98854106 unclassified probably benign
R5755:Kmt2d UTSW 15 98863646 missense unknown
R5817:Kmt2d UTSW 15 98862363 missense unknown
R5841:Kmt2d UTSW 15 98852109 unclassified probably benign
R5842:Kmt2d UTSW 15 98852109 unclassified probably benign
R5843:Kmt2d UTSW 15 98852109 unclassified probably benign
R5844:Kmt2d UTSW 15 98852109 unclassified probably benign
R5845:Kmt2d UTSW 15 98852109 unclassified probably benign
R6122:Kmt2d UTSW 15 98860692 unclassified probably benign
R6612:Kmt2d UTSW 15 98845858 unclassified probably benign
R6718:Kmt2d UTSW 15 98849586 unclassified probably benign
R6718:Kmt2d UTSW 15 98850539 unclassified probably benign
R6822:Kmt2d UTSW 15 98849459 unclassified probably benign
R6866:Kmt2d UTSW 15 98857393 unclassified probably benign
R6950:Kmt2d UTSW 15 98840020 unclassified probably benign
R7089:Kmt2d UTSW 15 98850272 missense unknown
R7120:Kmt2d UTSW 15 98861065 missense unknown
R7131:Kmt2d UTSW 15 98849616 unclassified probably benign
R7177:Kmt2d UTSW 15 98850386 missense unknown
R7194:Kmt2d UTSW 15 98843833 missense unknown
R7252:Kmt2d UTSW 15 98844266 missense unknown
R7282:Kmt2d UTSW 15 98854104 missense unknown
R7307:Kmt2d UTSW 15 98849418 missense unknown
R7313:Kmt2d UTSW 15 98856623 missense unknown
R7394:Kmt2d UTSW 15 98856384 missense unknown
R7404:Kmt2d UTSW 15 98845495 missense unknown
R7409:Kmt2d UTSW 15 98855354 missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98839856 missense unknown
R7534:Kmt2d UTSW 15 98852018 missense unknown
R7575:Kmt2d UTSW 15 98849611 unclassified probably benign
R7650:Kmt2d UTSW 15 98850870 missense unknown
R7687:Kmt2d UTSW 15 98862120 missense unknown
R7699:Kmt2d UTSW 15 98843719 missense unknown
R7700:Kmt2d UTSW 15 98843719 missense unknown
R7765:Kmt2d UTSW 15 98852334 missense unknown
R7797:Kmt2d UTSW 15 98864406 missense probably benign 0.24
R7803:Kmt2d UTSW 15 98862923 missense unknown
R7952:Kmt2d UTSW 15 98850768 missense unknown
R8054:Kmt2d UTSW 15 98843925 missense unknown
R8084:Kmt2d UTSW 15 98842064 missense unknown
R8089:Kmt2d UTSW 15 98842869 missense unknown
R8133:Kmt2d UTSW 15 98864942 missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98843653 missense unknown
R8343:Kmt2d UTSW 15 98852597 missense unknown
R8681:Kmt2d UTSW 15 98846067 missense unknown
R8694:Kmt2d UTSW 15 98844734 missense unknown
R8837:Kmt2d UTSW 15 98864167 missense unknown
R8855:Kmt2d UTSW 15 98856356 missense unknown
R8934:Kmt2d UTSW 15 98861886 missense unknown
R9100:Kmt2d UTSW 15 98849951 missense unknown
R9158:Kmt2d UTSW 15 98843139 missense unknown
R9190:Kmt2d UTSW 15 98852015 missense unknown
R9222:Kmt2d UTSW 15 98849443 missense unknown
R9263:Kmt2d UTSW 15 98849618 frame shift probably null
R9397:Kmt2d UTSW 15 98850113 missense unknown
R9415:Kmt2d UTSW 15 98839705 missense unknown
R9482:Kmt2d UTSW 15 98865165 missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98839768 missense unknown
R9610:Kmt2d UTSW 15 98845176 unclassified probably benign
R9611:Kmt2d UTSW 15 98845173 unclassified probably benign
R9611:Kmt2d UTSW 15 98845176 unclassified probably benign
R9612:Kmt2d UTSW 15 98845176 unclassified probably benign
R9613:Kmt2d UTSW 15 98845176 unclassified probably benign
R9644:Kmt2d UTSW 15 98845504 missense unknown
X0018:Kmt2d UTSW 15 98852922 unclassified probably benign
X0024:Kmt2d UTSW 15 98853053 unclassified probably benign
X0062:Kmt2d UTSW 15 98849819 unclassified probably benign
Z1187:Kmt2d UTSW 15 98851744 missense unknown
Z1188:Kmt2d UTSW 15 98851744 missense unknown
Z1189:Kmt2d UTSW 15 98851744 missense unknown
Z1190:Kmt2d UTSW 15 98851744 missense unknown
Z1192:Kmt2d UTSW 15 98851744 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAAGCCCTGTCATAGATCCC -3'
(R):5'- AACAAGGTCCCGGAGTACAG -3'

Sequencing Primer
(F):5'- AAAGCCCTGTCATAGATCCCTGTTG -3'
(R):5'- CGGAGTACAGAACCAGGCTCTG -3'
Posted On 2022-04-18