Incidental Mutation 'R9336:Vmn2r120'
ID 707196
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Name vomeronasal 2, receptor 120
Synonyms EG224916
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R9336 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 57508783-57545314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57525201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
AlphaFold A0A3Q4EG79
Predicted Effect possibly damaging
Transcript: ENSMUST00000165781
AA Change: D196V

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: D196V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C T 4: 147,945,033 R487C probably benign Het
2610044O15Rik8 A T 8: 129,217,668 D91E unknown Het
2900026A02Rik A T 5: 113,093,100 probably null Het
9130011E15Rik A T 19: 45,956,681 M277K probably damaging Het
Adamts15 T A 9: 30,904,789 T625S probably damaging Het
Adamtsl1 T C 4: 86,322,027 V675A probably benign Het
Ank3 A T 10: 69,973,748 T1120S probably benign Het
Babam2 A T 5: 31,701,850 M1L possibly damaging Het
Cadm3 G A 1: 173,341,219 Q261* probably null Het
Cdc27 A T 11: 104,505,670 D802E probably benign Het
Cfap206 C T 4: 34,716,494 V324I probably benign Het
Cfap44 T C 16: 44,422,444 I737T probably damaging Het
Chrm3 A T 13: 9,878,616 I128N probably damaging Het
Cyfip1 T A 7: 55,904,441 S743T probably benign Het
Ddias A G 7: 92,858,106 V867A possibly damaging Het
Ddx20 G C 3: 105,678,587 T814R possibly damaging Het
Dgka A T 10: 128,731,066 probably null Het
Dnah9 A T 11: 65,870,949 V3905E probably damaging Het
Dsg3 C A 18: 20,524,685 Q271K probably benign Het
Dvl2 T A 11: 70,006,354 I294N probably damaging Het
E2f3 G A 13: 29,911,256 H350Y possibly damaging Het
Eif2b5 G A 16: 20,505,277 D457N probably damaging Het
Erbb3 T C 10: 128,585,060 T125A probably benign Het
Etv5 A C 16: 22,435,877 C78G probably benign Het
Frrs1 G A 3: 116,890,933 R263H probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hivep3 A T 4: 120,095,203 I239F possibly damaging Het
Ifi208 C T 1: 173,682,828 T183I probably damaging Het
Ifitm2 AG A 7: 140,955,901 probably null Het
Igkv1-88 T A 6: 68,862,329 I100F probably damaging Het
Kmt2c T C 5: 25,409,167 N185S probably benign Het
Kmt2d A C 15: 98,845,816 L3821R unknown Het
Krtap22-2 T G 16: 89,010,590 Y40S unknown Het
Lrrc1 A G 9: 77,442,198 V362A probably damaging Het
Malsu1 T A 6: 49,084,515 I171N probably damaging Het
Mark1 C T 1: 184,916,148 G314S possibly damaging Het
Mib2 T C 4: 155,658,937 N135S probably benign Het
Mos A T 4: 3,870,886 L310Q probably damaging Het
Muc4 C T 16: 32,750,938 T272I possibly damaging Het
Myo15b A G 11: 115,880,238 T1654A Het
Napsa G T 7: 44,582,345 G153W probably damaging Het
Nos3 A C 5: 24,379,763 I722L probably benign Het
Olfr1457 A T 19: 13,095,149 S166R probably benign Het
Olfr406 A T 11: 74,269,917 D176V probably damaging Het
Olfr419 A T 1: 174,250,113 D271E probably damaging Het
Olfr555 A T 7: 102,658,992 H57L probably damaging Het
P4ha2 T A 11: 54,111,564 D109E possibly damaging Het
Pappa G T 4: 65,124,681 C47F unknown Het
Pbx3 T A 2: 34,371,820 H34L probably benign Het
Pcca A G 14: 122,650,326 T234A probably benign Het
Pcdha11 C T 18: 37,011,461 R202W probably damaging Het
Pcdhga1 T G 18: 37,662,198 V85G probably damaging Het
Pclo A G 5: 14,676,548 I1807V unknown Het
Pgm3 A T 9: 86,555,360 F528Y probably benign Het
Pigz T C 16: 31,944,876 Y251H probably damaging Het
Pik3c2g G T 6: 139,875,435 Q687H Het
Pja2 A T 17: 64,283,437 N700K unknown Het
Pkd2l2 T C 18: 34,428,105 F389L probably damaging Het
Plcz1 T A 6: 140,039,720 T32S possibly damaging Het
Pola2 A G 19: 5,941,001 V555A possibly damaging Het
Ppp4r3a A C 12: 101,049,660 C541G probably benign Het
Prr15l A T 11: 96,934,773 K76N probably damaging Het
Psg28 C A 7: 18,422,980 K443N possibly damaging Het
Ptch2 G T 4: 117,097,000 A76S probably damaging Het
Ptch2 A G 4: 117,109,579 D553G possibly damaging Het
Ptprz1 T C 6: 23,000,856 S982P probably benign Het
Rnd3 T C 2: 51,148,832 I15V probably benign Het
Rtn3 T C 19: 7,482,963 K41E unknown Het
Sap25 T C 5: 137,641,723 S30P probably benign Het
Scfd2 A T 5: 74,531,345 I92N probably damaging Het
Sdr16c5 T C 4: 4,016,108 Y106C probably damaging Het
Sell T C 1: 164,065,608 I131T probably damaging Het
Sesn3 T A 9: 14,314,554 V195D probably damaging Het
Setdb2 A G 14: 59,423,367 V109A unknown Het
Skint2 T C 4: 112,625,857 I153T probably benign Het
Slc22a1 A G 17: 12,667,255 S164P probably damaging Het
Sowahc G A 10: 59,222,483 G147D probably benign Het
Strip2 G C 6: 29,931,825 G456R probably benign Het
Synpo G T 18: 60,602,400 R825S probably damaging Het
Tango6 A G 8: 106,689,069 D174G probably benign Het
Tas1r2 T C 4: 139,662,005 F433S probably damaging Het
Tas2r126 T C 6: 42,434,943 S137P probably benign Het
Tbc1d15 A G 10: 115,208,961 F512S probably damaging Het
Tenm3 A T 8: 48,417,080 L226Q probably damaging Het
Tmod1 A G 4: 46,078,368 T59A probably damaging Het
Tmprss9 T A 10: 80,894,953 M771K probably benign Het
Trim29 T C 9: 43,327,053 Y485H possibly damaging Het
Ttc17 T C 2: 94,358,853 K144E probably benign Het
Ttc21b A G 2: 66,226,943 Y562H probably benign Het
Ugt2b5 T C 5: 87,137,271 H269R probably benign Het
Utp20 A G 10: 88,813,936 F471L probably damaging Het
Wdr72 T C 9: 74,210,010 V680A probably damaging Het
Wee1 G A 7: 110,122,482 G45S probably damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
R8882:Vmn2r120 UTSW 17 57545229 missense probably benign 0.01
R9134:Vmn2r120 UTSW 17 57525093 missense probably damaging 1.00
R9161:Vmn2r120 UTSW 17 57524864 missense
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTACCGGTATTTGAGACTGAGC -3'
(R):5'- TTCTGTTTAAGTTGGCAGCAAC -3'

Sequencing Primer
(F):5'- CATTTGTACAAAGGCTGCACAC -3'
(R):5'- CTTGCTTAGAATCCATTAGGG -3'
Posted On 2022-04-18