Incidental Mutation 'R9337:Grm8'
ID 707241
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Name glutamate receptor, metabotropic 8
Synonyms mGluR8, Gprc1h
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 27275119-28135178 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27761215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 337 (S337T)
Ref Sequence ENSEMBL: ENSMUSP00000087998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]
AlphaFold P47743
Predicted Effect probably benign
Transcript: ENSMUST00000090512
AA Change: S337T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: S337T

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115323
AA Change: S337T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: S337T

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115324
AA Change: S337T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: S337T

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131897
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adad1 T C 3: 37,085,098 V439A possibly damaging Het
Ahnak G A 19: 9,012,460 probably benign Het
Arhgef10l G A 4: 140,611,313 T46I probably damaging Het
BC022687 T C 12: 112,812,278 L218P probably damaging Het
C3ar1 A G 6: 122,850,319 V313A probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Ccdc30 T A 4: 119,333,723 probably null Het
Ccdc7a T C 8: 128,889,838 Q928R probably benign Het
Cept1 A G 3: 106,505,259 L299S possibly damaging Het
Cnot1 T C 8: 95,741,820 I1460M probably damaging Het
Col4a2 T C 8: 11,429,346 L743P probably benign Het
Cop1 T C 1: 159,244,651 V179A probably benign Het
Cpvl A G 6: 53,932,494 I219T probably damaging Het
Cyc1 T C 15: 76,344,306 V45A probably benign Het
Dnhd1 T A 7: 105,720,599 N4410K probably benign Het
Dok4 T A 8: 94,866,841 T106S probably benign Het
Exosc10 T C 4: 148,581,131 F842L probably damaging Het
Fam24b T A 7: 131,326,220 Y80F probably benign Het
Fbn2 G A 18: 58,209,651 A52V probably benign Het
Gal3st3 A T 19: 5,306,840 N81I probably damaging Het
Gm13283 T A 4: 88,760,799 V9E possibly damaging Het
Gm17026 A G 14: 42,258,916 S58P Het
Hdac5 G A 11: 102,205,352 P332S probably damaging Het
Hr A T 14: 70,559,884 E519V probably benign Het
Hspbap1 A G 16: 35,825,025 H360R probably benign Het
Iqgap3 T G 3: 88,116,118 probably null Het
Krtap5-3 T A 7: 142,202,530 H175Q unknown Het
Lrrn4 A T 2: 132,870,632 S424T probably benign Het
Lsm10 C A 4: 126,097,867 H5Q probably damaging Het
Megf10 A T 18: 57,261,180 K459* probably null Het
Myo15b A C 11: 115,859,035 K210N Het
Olfr1085 T C 2: 86,658,132 T109A probably benign Het
Olfr1126 T A 2: 87,457,183 I6N probably benign Het
Park7 A T 4: 150,907,096 C46S probably damaging Het
Pik3cb A G 9: 99,061,791 F653S probably damaging Het
Plekha1 T A 7: 130,909,618 C311S possibly damaging Het
Pprc1 T A 19: 46,063,759 M576K unknown Het
Prelid3b G A 2: 174,468,368 T74M probably benign Het
Prg4 T C 1: 150,451,365 Y311C probably damaging Het
Prom2 A C 2: 127,529,174 V801G probably damaging Het
Psmd9 T A 5: 123,248,324 V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 L647F probably damaging Het
Ptprj T C 2: 90,439,894 D1286G probably damaging Het
Rcc2 T C 4: 140,718,378 I449T probably damaging Het
Rev3l A T 10: 39,822,854 S1116C probably benign Het
Rnf212 A T 5: 108,774,889 S32T possibly damaging Het
Rnf40 T A 7: 127,589,000 S2T probably benign Het
Rrp8 T C 7: 105,734,177 D294G probably damaging Het
Rtf2 A T 2: 172,466,285 K201N probably damaging Het
Runx3 A G 4: 135,163,263 T173A probably damaging Het
Sardh T C 2: 27,196,666 I827M probably benign Het
Sec22b T C 3: 97,921,178 Y186H probably benign Het
Serpina5 C T 12: 104,105,283 T383I possibly damaging Het
Slc12a2 A G 18: 57,930,166 D906G probably damaging Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Stat1 G T 1: 52,152,270 A595S probably benign Het
Stat3 A T 11: 100,907,989 probably null Het
Styxl1 T C 5: 135,765,738 S82G probably benign Het
Taf1b T A 12: 24,547,122 D353E possibly damaging Het
Tbce T C 13: 14,019,813 K87R probably benign Het
Thada T C 17: 84,441,777 M589V probably benign Het
Them5 A G 3: 94,346,741 M257V unknown Het
Tln1 A T 4: 43,532,927 I2425N probably damaging Het
Tuba8 A G 6: 121,225,864 S379G probably damaging Het
Vrk1 T C 12: 106,058,698 probably null Het
Zbtb34 T C 2: 33,411,704 Y275C probably damaging Het
Zcwpw1 T C 5: 137,801,012 C214R probably benign Het
Zeb2 A G 2: 45,022,900 V137A probably benign Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27363801 missense probably damaging 1.00
IGL01412:Grm8 APN 6 27762461 missense probably damaging 1.00
IGL02329:Grm8 APN 6 27363116 missense probably damaging 1.00
IGL02342:Grm8 APN 6 27363804 missense probably benign 0.00
IGL02584:Grm8 APN 6 27762439 missense probably benign 0.35
IGL03040:Grm8 APN 6 28126123 start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27363263 missense probably damaging 1.00
IGL03139:Grm8 APN 6 27618650 missense probably damaging 1.00
IGL03287:Grm8 APN 6 27760255 missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27762390 missense probably damaging 0.99
R0266:Grm8 UTSW 6 27285896 missense probably damaging 1.00
R0347:Grm8 UTSW 6 27981222 missense probably benign 0.37
R0580:Grm8 UTSW 6 27761371 splice site probably benign
R0698:Grm8 UTSW 6 27363914 missense probably damaging 1.00
R0833:Grm8 UTSW 6 27363179 missense probably damaging 1.00
R1301:Grm8 UTSW 6 27981201 missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1471:Grm8 UTSW 6 27363309 missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28125853 missense probably benign 0.01
R1638:Grm8 UTSW 6 28125883 nonsense probably null
R1763:Grm8 UTSW 6 27285867 missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28125895 missense probably damaging 1.00
R1902:Grm8 UTSW 6 27429482 missense probably damaging 1.00
R1916:Grm8 UTSW 6 27363584 missense probably benign 0.01
R2257:Grm8 UTSW 6 27760225 missense probably damaging 0.98
R2351:Grm8 UTSW 6 28126119 missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27761242 missense probably damaging 0.98
R3801:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27761229 nonsense probably null
R3844:Grm8 UTSW 6 27429508 missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27981230 missense probably damaging 1.00
R4077:Grm8 UTSW 6 27760209 missense probably benign 0.01
R4395:Grm8 UTSW 6 27429432 missense probably damaging 0.98
R4436:Grm8 UTSW 6 27761238 missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27761296 missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27762419 missense probably damaging 1.00
R5677:Grm8 UTSW 6 27761204 critical splice donor site probably null
R5983:Grm8 UTSW 6 27760221 missense probably benign 0.03
R5990:Grm8 UTSW 6 27363624 missense probably damaging 1.00
R6365:Grm8 UTSW 6 27363227 missense probably damaging 1.00
R6454:Grm8 UTSW 6 27363776 missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27363191 missense probably damaging 1.00
R6960:Grm8 UTSW 6 27981282 missense probably damaging 0.98
R7194:Grm8 UTSW 6 27618487 missense probably benign 0.01
R7259:Grm8 UTSW 6 27760176 missense probably null 0.99
R7305:Grm8 UTSW 6 27761355 missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27762477 missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27429525 missense probably benign 0.44
R7605:Grm8 UTSW 6 27618679 missense probably damaging 1.00
R7651:Grm8 UTSW 6 27760258 missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27363672 missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27363672 missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27285787 missense probably benign
R7785:Grm8 UTSW 6 27618637 missense probably damaging 0.99
R7898:Grm8 UTSW 6 27762423 missense probably damaging 1.00
R8272:Grm8 UTSW 6 27363282 missense probably damaging 1.00
R8274:Grm8 UTSW 6 27761336 missense probably benign 0.31
R8501:Grm8 UTSW 6 27618541 missense probably damaging 0.98
R8695:Grm8 UTSW 6 28126031 missense probably benign 0.01
R8824:Grm8 UTSW 6 27761352 missense probably damaging 1.00
R8869:Grm8 UTSW 6 27363753 missense probably benign 0.26
R9322:Grm8 UTSW 6 27363729 missense possibly damaging 0.88
R9518:Grm8 UTSW 6 27429470 missense probably benign 0.01
RF013:Grm8 UTSW 6 27363780 missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28126027 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGACTACTGTGCTAAAGGTGC -3'
(R):5'- CTTCAGCACTGGTGTTATGATATCC -3'

Sequencing Primer
(F):5'- CTACTGTGCTAAAGGTGCATATTTC -3'
(R):5'- ATCCATAATTGTAGTCCCTTCCAAC -3'
Posted On 2022-04-18