Incidental Mutation 'R9337:Grm8'
ID 707241
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Name glutamate receptor, metabotropic 8
Synonyms mGluR8, Gprc1h
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 27275120-28135094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27761214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 337 (S337T)
Ref Sequence ENSEMBL: ENSMUSP00000087998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]
AlphaFold P47743
Predicted Effect probably benign
Transcript: ENSMUST00000090512
AA Change: S337T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: S337T

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115323
AA Change: S337T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: S337T

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115324
AA Change: S337T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: S337T

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131897
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adad1 T C 3: 37,139,247 (GRCm39) V439A possibly damaging Het
Ahnak G A 19: 8,989,824 (GRCm39) probably benign Het
Arhgef10l G A 4: 140,338,624 (GRCm39) T46I probably damaging Het
C3ar1 A G 6: 122,827,278 (GRCm39) V313A probably benign Het
Capn13 T A 17: 73,633,467 (GRCm39) probably null Het
Ccdc30 T A 4: 119,190,920 (GRCm39) probably null Het
Ccdc7a T C 8: 129,616,319 (GRCm39) Q928R probably benign Het
Cept1 A G 3: 106,412,575 (GRCm39) L299S possibly damaging Het
Clba1 T C 12: 112,775,898 (GRCm39) L218P probably damaging Het
Cnot1 T C 8: 96,468,448 (GRCm39) I1460M probably damaging Het
Col4a2 T C 8: 11,479,346 (GRCm39) L743P probably benign Het
Cop1 T C 1: 159,072,221 (GRCm39) V179A probably benign Het
Cpvl A G 6: 53,909,479 (GRCm39) I219T probably damaging Het
Cyc1 T C 15: 76,228,506 (GRCm39) V45A probably benign Het
Dnhd1 T A 7: 105,369,806 (GRCm39) N4410K probably benign Het
Dok4 T A 8: 95,593,469 (GRCm39) T106S probably benign Het
Exosc10 T C 4: 148,665,588 (GRCm39) F842L probably damaging Het
Fam24b T A 7: 130,927,949 (GRCm39) Y80F probably benign Het
Fbn2 G A 18: 58,342,723 (GRCm39) A52V probably benign Het
Gal3st3 A T 19: 5,356,868 (GRCm39) N81I probably damaging Het
Gm13283 T A 4: 88,679,036 (GRCm39) V9E possibly damaging Het
Gm17026 A G 14: 42,080,873 (GRCm39) S58P Het
Hdac5 G A 11: 102,096,178 (GRCm39) P332S probably damaging Het
Hr A T 14: 70,797,324 (GRCm39) E519V probably benign Het
Hspbap1 A G 16: 35,645,395 (GRCm39) H360R probably benign Het
Iqgap3 T G 3: 88,023,425 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,267 (GRCm39) H175Q unknown Het
Lrrn4 A T 2: 132,712,552 (GRCm39) S424T probably benign Het
Lsm10 C A 4: 125,991,660 (GRCm39) H5Q probably damaging Het
Megf10 A T 18: 57,394,252 (GRCm39) K459* probably null Het
Myo15b A C 11: 115,749,861 (GRCm39) K210N Het
Or12e7 T A 2: 87,287,527 (GRCm39) I6N probably benign Het
Or8k38 T C 2: 86,488,476 (GRCm39) T109A probably benign Het
Park7 A T 4: 150,991,553 (GRCm39) C46S probably damaging Het
Pik3cb A G 9: 98,943,844 (GRCm39) F653S probably damaging Het
Plekha1 T A 7: 130,511,348 (GRCm39) C311S possibly damaging Het
Pprc1 T A 19: 46,052,198 (GRCm39) M576K unknown Het
Prelid3b G A 2: 174,310,161 (GRCm39) T74M probably benign Het
Prg4 T C 1: 150,327,116 (GRCm39) Y311C probably damaging Het
Prom2 A C 2: 127,371,094 (GRCm39) V801G probably damaging Het
Psmd9 T A 5: 123,386,387 (GRCm39) V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 (GRCm39) L647F probably damaging Het
Ptprj T C 2: 90,270,238 (GRCm39) D1286G probably damaging Het
Rcc2 T C 4: 140,445,689 (GRCm39) I449T probably damaging Het
Rev3l A T 10: 39,698,850 (GRCm39) S1116C probably benign Het
Rnf212 A T 5: 108,922,755 (GRCm39) S32T possibly damaging Het
Rnf40 T A 7: 127,188,172 (GRCm39) S2T probably benign Het
Rrp8 T C 7: 105,383,384 (GRCm39) D294G probably damaging Het
Rtf2 A T 2: 172,308,205 (GRCm39) K201N probably damaging Het
Runx3 A G 4: 134,890,574 (GRCm39) T173A probably damaging Het
Sardh T C 2: 27,086,678 (GRCm39) I827M probably benign Het
Sec22b T C 3: 97,828,494 (GRCm39) Y186H probably benign Het
Serpina5 C T 12: 104,071,542 (GRCm39) T383I possibly damaging Het
Slc12a2 A G 18: 58,063,238 (GRCm39) D906G probably damaging Het
Socs1 T C 16: 10,602,578 (GRCm39) D53G possibly damaging Het
Stat1 G T 1: 52,191,429 (GRCm39) A595S probably benign Het
Stat3 A T 11: 100,798,815 (GRCm39) probably null Het
Styxl1 T C 5: 135,794,592 (GRCm39) S82G probably benign Het
Taf1b T A 12: 24,597,121 (GRCm39) D353E possibly damaging Het
Tbce T C 13: 14,194,398 (GRCm39) K87R probably benign Het
Thada T C 17: 84,749,205 (GRCm39) M589V probably benign Het
Them5 A G 3: 94,254,048 (GRCm39) M257V unknown Het
Tln1 A T 4: 43,532,927 (GRCm39) I2425N probably damaging Het
Tuba8 A G 6: 121,202,823 (GRCm39) S379G probably damaging Het
Vrk1 T C 12: 106,024,957 (GRCm39) probably null Het
Zbtb34 T C 2: 33,301,716 (GRCm39) Y275C probably damaging Het
Zcwpw1 T C 5: 137,799,274 (GRCm39) C214R probably benign Het
Zeb2 A G 2: 44,912,912 (GRCm39) V137A probably benign Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27,363,800 (GRCm39) missense probably damaging 1.00
IGL01412:Grm8 APN 6 27,762,460 (GRCm39) missense probably damaging 1.00
IGL02329:Grm8 APN 6 27,363,115 (GRCm39) missense probably damaging 1.00
IGL02342:Grm8 APN 6 27,363,803 (GRCm39) missense probably benign 0.00
IGL02584:Grm8 APN 6 27,762,438 (GRCm39) missense probably benign 0.35
IGL03040:Grm8 APN 6 28,126,122 (GRCm39) start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27,363,262 (GRCm39) missense probably damaging 1.00
IGL03139:Grm8 APN 6 27,618,649 (GRCm39) missense probably damaging 1.00
IGL03287:Grm8 APN 6 27,760,254 (GRCm39) missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27,762,389 (GRCm39) missense probably damaging 0.99
R0266:Grm8 UTSW 6 27,285,895 (GRCm39) missense probably damaging 1.00
R0347:Grm8 UTSW 6 27,981,221 (GRCm39) missense probably benign 0.37
R0580:Grm8 UTSW 6 27,761,370 (GRCm39) splice site probably benign
R0698:Grm8 UTSW 6 27,363,913 (GRCm39) missense probably damaging 1.00
R0833:Grm8 UTSW 6 27,363,178 (GRCm39) missense probably damaging 1.00
R1301:Grm8 UTSW 6 27,981,200 (GRCm39) missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1471:Grm8 UTSW 6 27,363,308 (GRCm39) missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28,125,852 (GRCm39) missense probably benign 0.01
R1638:Grm8 UTSW 6 28,125,882 (GRCm39) nonsense probably null
R1763:Grm8 UTSW 6 27,285,866 (GRCm39) missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28,125,894 (GRCm39) missense probably damaging 1.00
R1902:Grm8 UTSW 6 27,429,481 (GRCm39) missense probably damaging 1.00
R1916:Grm8 UTSW 6 27,363,583 (GRCm39) missense probably benign 0.01
R2257:Grm8 UTSW 6 27,760,224 (GRCm39) missense probably damaging 0.98
R2351:Grm8 UTSW 6 28,126,118 (GRCm39) missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27,761,241 (GRCm39) missense probably damaging 0.98
R3801:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27,761,228 (GRCm39) nonsense probably null
R3844:Grm8 UTSW 6 27,429,507 (GRCm39) missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27,981,229 (GRCm39) missense probably damaging 1.00
R4077:Grm8 UTSW 6 27,760,208 (GRCm39) missense probably benign 0.01
R4395:Grm8 UTSW 6 27,429,431 (GRCm39) missense probably damaging 0.98
R4436:Grm8 UTSW 6 27,761,237 (GRCm39) missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27,761,295 (GRCm39) missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27,762,418 (GRCm39) missense probably damaging 1.00
R5677:Grm8 UTSW 6 27,761,203 (GRCm39) critical splice donor site probably null
R5983:Grm8 UTSW 6 27,760,220 (GRCm39) missense probably benign 0.03
R5990:Grm8 UTSW 6 27,363,623 (GRCm39) missense probably damaging 1.00
R6365:Grm8 UTSW 6 27,363,226 (GRCm39) missense probably damaging 1.00
R6454:Grm8 UTSW 6 27,363,775 (GRCm39) missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27,363,190 (GRCm39) missense probably damaging 1.00
R6960:Grm8 UTSW 6 27,981,281 (GRCm39) missense probably damaging 0.98
R7194:Grm8 UTSW 6 27,618,486 (GRCm39) missense probably benign 0.01
R7259:Grm8 UTSW 6 27,760,175 (GRCm39) missense probably null 0.99
R7305:Grm8 UTSW 6 27,761,354 (GRCm39) missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27,762,476 (GRCm39) missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27,429,524 (GRCm39) missense probably benign 0.44
R7605:Grm8 UTSW 6 27,618,678 (GRCm39) missense probably damaging 1.00
R7651:Grm8 UTSW 6 27,760,257 (GRCm39) missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27,285,786 (GRCm39) missense probably benign
R7785:Grm8 UTSW 6 27,618,636 (GRCm39) missense probably damaging 0.99
R7898:Grm8 UTSW 6 27,762,422 (GRCm39) missense probably damaging 1.00
R8272:Grm8 UTSW 6 27,363,281 (GRCm39) missense probably damaging 1.00
R8274:Grm8 UTSW 6 27,761,335 (GRCm39) missense probably benign 0.31
R8501:Grm8 UTSW 6 27,618,540 (GRCm39) missense probably damaging 0.98
R8695:Grm8 UTSW 6 28,126,030 (GRCm39) missense probably benign 0.01
R8824:Grm8 UTSW 6 27,761,351 (GRCm39) missense probably damaging 1.00
R8869:Grm8 UTSW 6 27,363,752 (GRCm39) missense probably benign 0.26
R9322:Grm8 UTSW 6 27,363,728 (GRCm39) missense possibly damaging 0.88
R9518:Grm8 UTSW 6 27,429,469 (GRCm39) missense probably benign 0.01
RF013:Grm8 UTSW 6 27,363,779 (GRCm39) missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28,126,026 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGACTACTGTGCTAAAGGTGC -3'
(R):5'- CTTCAGCACTGGTGTTATGATATCC -3'

Sequencing Primer
(F):5'- CTACTGTGCTAAAGGTGCATATTTC -3'
(R):5'- ATCCATAATTGTAGTCCCTTCCAAC -3'
Posted On 2022-04-18