Incidental Mutation 'R9337:Pik3cb'
ID 707255
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms 1110001J02Rik, p110beta
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 98920455-99022264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98943844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 653 (F653S)
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
AlphaFold Q8BTI9
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035037
AA Change: F653S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: F653S

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Meta Mutation Damage Score 0.9565 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adad1 T C 3: 37,139,247 (GRCm39) V439A possibly damaging Het
Ahnak G A 19: 8,989,824 (GRCm39) probably benign Het
Arhgef10l G A 4: 140,338,624 (GRCm39) T46I probably damaging Het
C3ar1 A G 6: 122,827,278 (GRCm39) V313A probably benign Het
Capn13 T A 17: 73,633,467 (GRCm39) probably null Het
Ccdc30 T A 4: 119,190,920 (GRCm39) probably null Het
Ccdc7a T C 8: 129,616,319 (GRCm39) Q928R probably benign Het
Cept1 A G 3: 106,412,575 (GRCm39) L299S possibly damaging Het
Clba1 T C 12: 112,775,898 (GRCm39) L218P probably damaging Het
Cnot1 T C 8: 96,468,448 (GRCm39) I1460M probably damaging Het
Col4a2 T C 8: 11,479,346 (GRCm39) L743P probably benign Het
Cop1 T C 1: 159,072,221 (GRCm39) V179A probably benign Het
Cpvl A G 6: 53,909,479 (GRCm39) I219T probably damaging Het
Cyc1 T C 15: 76,228,506 (GRCm39) V45A probably benign Het
Dnhd1 T A 7: 105,369,806 (GRCm39) N4410K probably benign Het
Dok4 T A 8: 95,593,469 (GRCm39) T106S probably benign Het
Exosc10 T C 4: 148,665,588 (GRCm39) F842L probably damaging Het
Fam24b T A 7: 130,927,949 (GRCm39) Y80F probably benign Het
Fbn2 G A 18: 58,342,723 (GRCm39) A52V probably benign Het
Gal3st3 A T 19: 5,356,868 (GRCm39) N81I probably damaging Het
Gm13283 T A 4: 88,679,036 (GRCm39) V9E possibly damaging Het
Gm17026 A G 14: 42,080,873 (GRCm39) S58P Het
Grm8 A T 6: 27,761,214 (GRCm39) S337T probably benign Het
Hdac5 G A 11: 102,096,178 (GRCm39) P332S probably damaging Het
Hr A T 14: 70,797,324 (GRCm39) E519V probably benign Het
Hspbap1 A G 16: 35,645,395 (GRCm39) H360R probably benign Het
Iqgap3 T G 3: 88,023,425 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,267 (GRCm39) H175Q unknown Het
Lrrn4 A T 2: 132,712,552 (GRCm39) S424T probably benign Het
Lsm10 C A 4: 125,991,660 (GRCm39) H5Q probably damaging Het
Megf10 A T 18: 57,394,252 (GRCm39) K459* probably null Het
Myo15b A C 11: 115,749,861 (GRCm39) K210N Het
Or12e7 T A 2: 87,287,527 (GRCm39) I6N probably benign Het
Or8k38 T C 2: 86,488,476 (GRCm39) T109A probably benign Het
Park7 A T 4: 150,991,553 (GRCm39) C46S probably damaging Het
Plekha1 T A 7: 130,511,348 (GRCm39) C311S possibly damaging Het
Pprc1 T A 19: 46,052,198 (GRCm39) M576K unknown Het
Prelid3b G A 2: 174,310,161 (GRCm39) T74M probably benign Het
Prg4 T C 1: 150,327,116 (GRCm39) Y311C probably damaging Het
Prom2 A C 2: 127,371,094 (GRCm39) V801G probably damaging Het
Psmd9 T A 5: 123,386,387 (GRCm39) V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 (GRCm39) L647F probably damaging Het
Ptprj T C 2: 90,270,238 (GRCm39) D1286G probably damaging Het
Rcc2 T C 4: 140,445,689 (GRCm39) I449T probably damaging Het
Rev3l A T 10: 39,698,850 (GRCm39) S1116C probably benign Het
Rnf212 A T 5: 108,922,755 (GRCm39) S32T possibly damaging Het
Rnf40 T A 7: 127,188,172 (GRCm39) S2T probably benign Het
Rrp8 T C 7: 105,383,384 (GRCm39) D294G probably damaging Het
Rtf2 A T 2: 172,308,205 (GRCm39) K201N probably damaging Het
Runx3 A G 4: 134,890,574 (GRCm39) T173A probably damaging Het
Sardh T C 2: 27,086,678 (GRCm39) I827M probably benign Het
Sec22b T C 3: 97,828,494 (GRCm39) Y186H probably benign Het
Serpina5 C T 12: 104,071,542 (GRCm39) T383I possibly damaging Het
Slc12a2 A G 18: 58,063,238 (GRCm39) D906G probably damaging Het
Socs1 T C 16: 10,602,578 (GRCm39) D53G possibly damaging Het
Stat1 G T 1: 52,191,429 (GRCm39) A595S probably benign Het
Stat3 A T 11: 100,798,815 (GRCm39) probably null Het
Styxl1 T C 5: 135,794,592 (GRCm39) S82G probably benign Het
Taf1b T A 12: 24,597,121 (GRCm39) D353E possibly damaging Het
Tbce T C 13: 14,194,398 (GRCm39) K87R probably benign Het
Thada T C 17: 84,749,205 (GRCm39) M589V probably benign Het
Them5 A G 3: 94,254,048 (GRCm39) M257V unknown Het
Tln1 A T 4: 43,532,927 (GRCm39) I2425N probably damaging Het
Tuba8 A G 6: 121,202,823 (GRCm39) S379G probably damaging Het
Vrk1 T C 12: 106,024,957 (GRCm39) probably null Het
Zbtb34 T C 2: 33,301,716 (GRCm39) Y275C probably damaging Het
Zcwpw1 T C 5: 137,799,274 (GRCm39) C214R probably benign Het
Zeb2 A G 2: 44,912,912 (GRCm39) V137A probably benign Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 98,983,339 (GRCm39) missense probably damaging 0.96
IGL01354:Pik3cb APN 9 98,946,221 (GRCm39) missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 98,953,430 (GRCm39) missense probably benign 0.01
IGL02268:Pik3cb APN 9 98,928,609 (GRCm39) missense probably benign 0.00
IGL02376:Pik3cb APN 9 98,934,405 (GRCm39) missense probably benign 0.00
IGL02378:Pik3cb APN 9 98,944,893 (GRCm39) missense probably benign 0.40
IGL02748:Pik3cb APN 9 98,945,021 (GRCm39) splice site probably benign
IGL03038:Pik3cb APN 9 98,947,650 (GRCm39) missense probably damaging 1.00
IGL03142:Pik3cb APN 9 98,947,615 (GRCm39) missense probably benign 0.10
H8786:Pik3cb UTSW 9 98,928,612 (GRCm39) missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 98,926,918 (GRCm39) missense probably benign 0.02
R0071:Pik3cb UTSW 9 98,926,918 (GRCm39) missense probably benign 0.02
R0305:Pik3cb UTSW 9 98,946,129 (GRCm39) missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 98,926,796 (GRCm39) critical splice donor site probably null
R0635:Pik3cb UTSW 9 98,946,271 (GRCm39) splice site probably benign
R1386:Pik3cb UTSW 9 98,946,080 (GRCm39) missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 98,936,026 (GRCm39) missense probably damaging 0.96
R1802:Pik3cb UTSW 9 98,983,342 (GRCm39) nonsense probably null
R1815:Pik3cb UTSW 9 98,975,148 (GRCm39) missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 98,987,632 (GRCm39) nonsense probably null
R2079:Pik3cb UTSW 9 98,942,257 (GRCm39) missense probably benign 0.27
R2153:Pik3cb UTSW 9 98,983,297 (GRCm39) nonsense probably null
R2237:Pik3cb UTSW 9 98,923,081 (GRCm39) missense probably damaging 1.00
R2238:Pik3cb UTSW 9 98,923,081 (GRCm39) missense probably damaging 1.00
R2513:Pik3cb UTSW 9 98,943,895 (GRCm39) missense probably damaging 1.00
R3982:Pik3cb UTSW 9 98,928,654 (GRCm39) missense probably benign 0.06
R4009:Pik3cb UTSW 9 98,922,982 (GRCm39) missense probably damaging 0.98
R4246:Pik3cb UTSW 9 98,983,229 (GRCm39) splice site probably null
R4248:Pik3cb UTSW 9 98,983,229 (GRCm39) splice site probably null
R4249:Pik3cb UTSW 9 98,983,229 (GRCm39) splice site probably null
R4334:Pik3cb UTSW 9 98,943,904 (GRCm39) missense probably damaging 1.00
R4544:Pik3cb UTSW 9 98,921,812 (GRCm39) missense probably damaging 1.00
R4568:Pik3cb UTSW 9 98,972,355 (GRCm39) missense probably benign 0.00
R4571:Pik3cb UTSW 9 98,972,310 (GRCm39) missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 98,937,459 (GRCm39) missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 98,943,817 (GRCm39) missense probably benign 0.15
R4820:Pik3cb UTSW 9 98,955,679 (GRCm39) missense probably benign 0.00
R4887:Pik3cb UTSW 9 98,983,381 (GRCm39) missense probably damaging 0.99
R4967:Pik3cb UTSW 9 98,987,685 (GRCm39) missense probably benign 0.14
R5029:Pik3cb UTSW 9 98,936,113 (GRCm39) missense probably damaging 0.98
R5031:Pik3cb UTSW 9 98,953,461 (GRCm39) missense probably damaging 1.00
R5394:Pik3cb UTSW 9 98,970,716 (GRCm39) missense probably benign
R5769:Pik3cb UTSW 9 98,975,212 (GRCm39) nonsense probably null
R6128:Pik3cb UTSW 9 98,946,152 (GRCm39) missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 98,976,651 (GRCm39) missense probably benign 0.01
R6354:Pik3cb UTSW 9 98,955,696 (GRCm39) missense probably benign 0.00
R6370:Pik3cb UTSW 9 98,922,987 (GRCm39) missense probably damaging 1.00
R6664:Pik3cb UTSW 9 98,976,591 (GRCm39) missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 98,955,702 (GRCm39) missense probably benign 0.00
R6751:Pik3cb UTSW 9 98,976,574 (GRCm39) missense probably benign
R6781:Pik3cb UTSW 9 98,923,045 (GRCm39) missense possibly damaging 0.52
R6869:Pik3cb UTSW 9 98,942,312 (GRCm39) missense probably benign 0.08
R6883:Pik3cb UTSW 9 98,983,453 (GRCm39) missense probably benign 0.00
R7150:Pik3cb UTSW 9 98,975,143 (GRCm39) missense probably damaging 1.00
R7446:Pik3cb UTSW 9 98,928,711 (GRCm39) missense probably damaging 1.00
R7679:Pik3cb UTSW 9 98,970,660 (GRCm39) missense probably benign 0.05
R7831:Pik3cb UTSW 9 98,970,666 (GRCm39) missense probably benign
R8300:Pik3cb UTSW 9 98,928,711 (GRCm39) missense probably damaging 1.00
R8837:Pik3cb UTSW 9 98,936,117 (GRCm39) missense possibly damaging 0.65
R8911:Pik3cb UTSW 9 98,946,201 (GRCm39) missense probably benign 0.40
R9299:Pik3cb UTSW 9 98,943,844 (GRCm39) missense probably damaging 1.00
R9477:Pik3cb UTSW 9 98,922,973 (GRCm39) critical splice donor site probably null
R9641:Pik3cb UTSW 9 98,955,789 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTAAATGTCACGGATGG -3'
(R):5'- TGTAAGCACATGACAGGCCTG -3'

Sequencing Primer
(F):5'- TGTAAATGTCACGGATGGATCAG -3'
(R):5'- ACATGACAGGCCTGGTCCAG -3'
Posted On 2022-04-18