Mutagenetix > Incidental Mutation

Incidental Mutation 'R9337:Serpina5'

707261

Institutional Source

Beutler Lab

Gene Symbol

Serpina5

Ensembl Gene

ENSMUSG00000041550

Gene Name

serine (or cysteine) peptidase inhibitor, clade A, member 5

Synonyms

alpha-1 antiproteinase, Pci, PAI-3, antitrypsin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9337 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104101113-104106137 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104105283 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 383 (T383I)

Ref Sequence

ENSEMBL: ENSMUSP00000021495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021495]

AlphaFold

P70458

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021495
AA Change: T383I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021495
Gene: ENSMUSG00000041550
AA Change: T383I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SERPIN	48	405	1.4e-160	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal with the exception that males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,090,113	T22A	possibly damaging	Het
Adad1	T	C	3: 37,085,098	V439A	possibly damaging	Het
Ahnak	G	A	19: 9,012,460		probably benign	Het
Arhgef10l	G	A	4: 140,611,313	T46I	probably damaging	Het
BC022687	T	C	12: 112,812,278	L218P	probably damaging	Het
C3ar1	A	G	6: 122,850,319	V313A	probably benign	Het
Capn13	T	A	17: 73,326,472		probably null	Het
Ccdc30	T	A	4: 119,333,723		probably null	Het
Ccdc7a	T	C	8: 128,889,838	Q928R	probably benign	Het
Cept1	A	G	3: 106,505,259	L299S	possibly damaging	Het
Cnot1	T	C	8: 95,741,820	I1460M	probably damaging	Het
Col4a2	T	C	8: 11,429,346	L743P	probably benign	Het
Cop1	T	C	1: 159,244,651	V179A	probably benign	Het
Cpvl	A	G	6: 53,932,494	I219T	probably damaging	Het
Cyc1	T	C	15: 76,344,306	V45A	probably benign	Het
Dnhd1	T	A	7: 105,720,599	N4410K	probably benign	Het
Dok4	T	A	8: 94,866,841	T106S	probably benign	Het
Exosc10	T	C	4: 148,581,131	F842L	probably damaging	Het
Fam24b	T	A	7: 131,326,220	Y80F	probably benign	Het
Fbn2	G	A	18: 58,209,651	A52V	probably benign	Het
Gal3st3	A	T	19: 5,306,840	N81I	probably damaging	Het
Gm13283	T	A	4: 88,760,799	V9E	possibly damaging	Het
Gm17026	A	G	14: 42,258,916	S58P		Het
Grm8	A	T	6: 27,761,215	S337T	probably benign	Het
Hdac5	G	A	11: 102,205,352	P332S	probably damaging	Het
Hr	A	T	14: 70,559,884	E519V	probably benign	Het
Hspbap1	A	G	16: 35,825,025	H360R	probably benign	Het
Iqgap3	T	G	3: 88,116,118		probably null	Het
Krtap5-3	T	A	7: 142,202,530	H175Q	unknown	Het
Lrrn4	A	T	2: 132,870,632	S424T	probably benign	Het
Lsm10	C	A	4: 126,097,867	H5Q	probably damaging	Het
Megf10	A	T	18: 57,261,180	K459*	probably null	Het
Myo15b	A	C	11: 115,859,035	K210N		Het
Olfr1085	T	C	2: 86,658,132	T109A	probably benign	Het
Olfr1126	T	A	2: 87,457,183	I6N	probably benign	Het
Park7	A	T	4: 150,907,096	C46S	probably damaging	Het
Pik3cb	A	G	9: 99,061,791	F653S	probably damaging	Het
Plekha1	T	A	7: 130,909,618	C311S	possibly damaging	Het
Pprc1	T	A	19: 46,063,759	M576K	unknown	Het
Prelid3b	G	A	2: 174,468,368	T74M	probably benign	Het
Prg4	T	C	1: 150,451,365	Y311C	probably damaging	Het
Prom2	A	C	2: 127,529,174	V801G	probably damaging	Het
Psmd9	T	A	5: 123,248,324	V44D	probably damaging	Het
Ptpn3	C	G	4: 57,218,521	L647F	probably damaging	Het
Ptprj	T	C	2: 90,439,894	D1286G	probably damaging	Het
Rcc2	T	C	4: 140,718,378	I449T	probably damaging	Het
Rev3l	A	T	10: 39,822,854	S1116C	probably benign	Het
Rnf212	A	T	5: 108,774,889	S32T	possibly damaging	Het
Rnf40	T	A	7: 127,589,000	S2T	probably benign	Het
Rrp8	T	C	7: 105,734,177	D294G	probably damaging	Het
Rtf2	A	T	2: 172,466,285	K201N	probably damaging	Het
Runx3	A	G	4: 135,163,263	T173A	probably damaging	Het
Sardh	T	C	2: 27,196,666	I827M	probably benign	Het
Sec22b	T	C	3: 97,921,178	Y186H	probably benign	Het
Slc12a2	A	G	18: 57,930,166	D906G	probably damaging	Het
Socs1	T	C	16: 10,784,714	D53G	possibly damaging	Het
Stat1	G	T	1: 52,152,270	A595S	probably benign	Het
Stat3	A	T	11: 100,907,989		probably null	Het
Styxl1	T	C	5: 135,765,738	S82G	probably benign	Het
Taf1b	T	A	12: 24,547,122	D353E	possibly damaging	Het
Tbce	T	C	13: 14,019,813	K87R	probably benign	Het
Thada	T	C	17: 84,441,777	M589V	probably benign	Het
Them5	A	G	3: 94,346,741	M257V	unknown	Het
Tln1	A	T	4: 43,532,927	I2425N	probably damaging	Het
Tuba8	A	G	6: 121,225,864	S379G	probably damaging	Het
Vrk1	T	C	12: 106,058,698		probably null	Het
Zbtb34	T	C	2: 33,411,704	Y275C	probably damaging	Het
Zcwpw1	T	C	5: 137,801,012	C214R	probably benign	Het
Zeb2	A	G	2: 45,022,900	V137A	probably benign	Het

Other mutations in Serpina5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Serpina5	APN	12	104105220	missense	probably damaging	1.00
IGL01138:Serpina5	APN	12	104103744	missense	possibly damaging	0.60
IGL01526:Serpina5	APN	12	104101890	missense	probably damaging	1.00
IGL02159:Serpina5	APN	12	104105298	missense	possibly damaging	0.95
IGL02351:Serpina5	APN	12	104102125	missense	probably damaging	1.00
IGL02358:Serpina5	APN	12	104102125	missense	probably damaging	1.00
IGL02735:Serpina5	APN	12	104103857	missense	probably benign	0.21
IGL03087:Serpina5	APN	12	104101733	missense	probably benign	0.01
R0189:Serpina5	UTSW	12	104103330	missense	probably damaging	1.00
R0304:Serpina5	UTSW	12	104103200	missense	possibly damaging	0.76
R0492:Serpina5	UTSW	12	104102133	missense	probably damaging	1.00
R0511:Serpina5	UTSW	12	104103362	missense	probably benign	0.00
R0611:Serpina5	UTSW	12	104103787	missense	probably benign
R1016:Serpina5	UTSW	12	104105323	missense	probably damaging	0.97
R1649:Serpina5	UTSW	12	104105225	missense	possibly damaging	0.94
R1970:Serpina5	UTSW	12	104103857	missense	probably benign	0.02
R4429:Serpina5	UTSW	12	104103406	missense	probably benign	0.00
R4805:Serpina5	UTSW	12	104102201	missense	probably damaging	0.97
R5608:Serpina5	UTSW	12	104103744	missense	probably damaging	1.00
R6226:Serpina5	UTSW	12	104101778	missense	possibly damaging	0.72
R7097:Serpina5	UTSW	12	104102295	critical splice donor site	probably null
R7357:Serpina5	UTSW	12	104103380	missense	possibly damaging	0.85
R8208:Serpina5	UTSW	12	104105273	missense	probably benign	0.00
R9383:Serpina5	UTSW	12	104103872	missense	probably damaging	1.00
R9526:Serpina5	UTSW	12	104103144	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTAATGCTGTTATCATGGTGCATC -3'
(R):5'- CTGTGATCAAGGAAGCAGCCATAG -3'

Sequencing Primer
(F):5'- TCACCATAACCCAGCCCTTCTG -3'
(R):5'- GCAGCCATAGGGATATTGATCTTATC -3'

Posted On

2022-04-18