Incidental Mutation 'R9337:Hr'
ID 707266
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Name lysine demethylase and nuclear receptor corepressor
Synonyms rh-bmh, rh, N, bldy, ba
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70789652-70810988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70797324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 519 (E519V)
Ref Sequence ENSEMBL: ENSMUSP00000124816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
AlphaFold Q61645
Predicted Effect probably benign
Transcript: ENSMUST00000022691
AA Change: E519V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: E519V

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161069
AA Change: E519V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: E519V

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163060
AA Change: E548V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: E548V

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adad1 T C 3: 37,139,247 (GRCm39) V439A possibly damaging Het
Ahnak G A 19: 8,989,824 (GRCm39) probably benign Het
Arhgef10l G A 4: 140,338,624 (GRCm39) T46I probably damaging Het
C3ar1 A G 6: 122,827,278 (GRCm39) V313A probably benign Het
Capn13 T A 17: 73,633,467 (GRCm39) probably null Het
Ccdc30 T A 4: 119,190,920 (GRCm39) probably null Het
Ccdc7a T C 8: 129,616,319 (GRCm39) Q928R probably benign Het
Cept1 A G 3: 106,412,575 (GRCm39) L299S possibly damaging Het
Clba1 T C 12: 112,775,898 (GRCm39) L218P probably damaging Het
Cnot1 T C 8: 96,468,448 (GRCm39) I1460M probably damaging Het
Col4a2 T C 8: 11,479,346 (GRCm39) L743P probably benign Het
Cop1 T C 1: 159,072,221 (GRCm39) V179A probably benign Het
Cpvl A G 6: 53,909,479 (GRCm39) I219T probably damaging Het
Cyc1 T C 15: 76,228,506 (GRCm39) V45A probably benign Het
Dnhd1 T A 7: 105,369,806 (GRCm39) N4410K probably benign Het
Dok4 T A 8: 95,593,469 (GRCm39) T106S probably benign Het
Exosc10 T C 4: 148,665,588 (GRCm39) F842L probably damaging Het
Fam24b T A 7: 130,927,949 (GRCm39) Y80F probably benign Het
Fbn2 G A 18: 58,342,723 (GRCm39) A52V probably benign Het
Gal3st3 A T 19: 5,356,868 (GRCm39) N81I probably damaging Het
Gm13283 T A 4: 88,679,036 (GRCm39) V9E possibly damaging Het
Gm17026 A G 14: 42,080,873 (GRCm39) S58P Het
Grm8 A T 6: 27,761,214 (GRCm39) S337T probably benign Het
Hdac5 G A 11: 102,096,178 (GRCm39) P332S probably damaging Het
Hspbap1 A G 16: 35,645,395 (GRCm39) H360R probably benign Het
Iqgap3 T G 3: 88,023,425 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,267 (GRCm39) H175Q unknown Het
Lrrn4 A T 2: 132,712,552 (GRCm39) S424T probably benign Het
Lsm10 C A 4: 125,991,660 (GRCm39) H5Q probably damaging Het
Megf10 A T 18: 57,394,252 (GRCm39) K459* probably null Het
Myo15b A C 11: 115,749,861 (GRCm39) K210N Het
Or12e7 T A 2: 87,287,527 (GRCm39) I6N probably benign Het
Or8k38 T C 2: 86,488,476 (GRCm39) T109A probably benign Het
Park7 A T 4: 150,991,553 (GRCm39) C46S probably damaging Het
Pik3cb A G 9: 98,943,844 (GRCm39) F653S probably damaging Het
Plekha1 T A 7: 130,511,348 (GRCm39) C311S possibly damaging Het
Pprc1 T A 19: 46,052,198 (GRCm39) M576K unknown Het
Prelid3b G A 2: 174,310,161 (GRCm39) T74M probably benign Het
Prg4 T C 1: 150,327,116 (GRCm39) Y311C probably damaging Het
Prom2 A C 2: 127,371,094 (GRCm39) V801G probably damaging Het
Psmd9 T A 5: 123,386,387 (GRCm39) V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 (GRCm39) L647F probably damaging Het
Ptprj T C 2: 90,270,238 (GRCm39) D1286G probably damaging Het
Rcc2 T C 4: 140,445,689 (GRCm39) I449T probably damaging Het
Rev3l A T 10: 39,698,850 (GRCm39) S1116C probably benign Het
Rnf212 A T 5: 108,922,755 (GRCm39) S32T possibly damaging Het
Rnf40 T A 7: 127,188,172 (GRCm39) S2T probably benign Het
Rrp8 T C 7: 105,383,384 (GRCm39) D294G probably damaging Het
Rtf2 A T 2: 172,308,205 (GRCm39) K201N probably damaging Het
Runx3 A G 4: 134,890,574 (GRCm39) T173A probably damaging Het
Sardh T C 2: 27,086,678 (GRCm39) I827M probably benign Het
Sec22b T C 3: 97,828,494 (GRCm39) Y186H probably benign Het
Serpina5 C T 12: 104,071,542 (GRCm39) T383I possibly damaging Het
Slc12a2 A G 18: 58,063,238 (GRCm39) D906G probably damaging Het
Socs1 T C 16: 10,602,578 (GRCm39) D53G possibly damaging Het
Stat1 G T 1: 52,191,429 (GRCm39) A595S probably benign Het
Stat3 A T 11: 100,798,815 (GRCm39) probably null Het
Styxl1 T C 5: 135,794,592 (GRCm39) S82G probably benign Het
Taf1b T A 12: 24,597,121 (GRCm39) D353E possibly damaging Het
Tbce T C 13: 14,194,398 (GRCm39) K87R probably benign Het
Thada T C 17: 84,749,205 (GRCm39) M589V probably benign Het
Them5 A G 3: 94,254,048 (GRCm39) M257V unknown Het
Tln1 A T 4: 43,532,927 (GRCm39) I2425N probably damaging Het
Tuba8 A G 6: 121,202,823 (GRCm39) S379G probably damaging Het
Vrk1 T C 12: 106,024,957 (GRCm39) probably null Het
Zbtb34 T C 2: 33,301,716 (GRCm39) Y275C probably damaging Het
Zcwpw1 T C 5: 137,799,274 (GRCm39) C214R probably benign Het
Zeb2 A G 2: 44,912,912 (GRCm39) V137A probably benign Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70,802,737 (GRCm39) splice site probably benign
IGL02020:Hr APN 14 70,793,877 (GRCm39) missense probably benign 0.01
IGL02372:Hr APN 14 70,795,790 (GRCm39) missense possibly damaging 0.94
IGL02380:Hr APN 14 70,795,201 (GRCm39) missense probably damaging 0.98
IGL02554:Hr APN 14 70,797,306 (GRCm39) splice site probably benign
IGL02949:Hr APN 14 70,797,225 (GRCm39) missense possibly damaging 0.87
IGL03406:Hr APN 14 70,800,860 (GRCm39) critical splice donor site probably null
angie UTSW 14 70,805,273 (GRCm39) missense probably damaging 0.97
blofeld UTSW 14 70,805,525 (GRCm39) missense probably damaging 1.00
general UTSW 14 70,801,124 (GRCm39) critical splice donor site probably null
kaburo UTSW 14 0 () unclassified
mister_clean UTSW 14 70,797,504 (GRCm39) critical splice donor site probably benign
mushroom UTSW 14 70,805,525 (GRCm39) missense probably damaging 1.00
prune UTSW 14 70,808,869 (GRCm39) missense probably damaging 1.00
ren UTSW 14 70,805,525 (GRCm39) missense probably damaging 1.00
subclinical UTSW 14 70,799,276 (GRCm39) missense possibly damaging 0.89
vessel UTSW 14 70,799,305 (GRCm39) nonsense probably null
yuanxiao UTSW 14 70,808,888 (GRCm39) missense probably damaging 1.00
R0018:Hr UTSW 14 70,795,717 (GRCm39) missense probably benign
R0038:Hr UTSW 14 70,805,525 (GRCm39) missense probably damaging 1.00
R0374:Hr UTSW 14 70,793,916 (GRCm39) missense probably benign 0.01
R0511:Hr UTSW 14 70,799,352 (GRCm39) nonsense probably null
R0609:Hr UTSW 14 70,797,097 (GRCm39) missense probably benign
R1828:Hr UTSW 14 70,809,477 (GRCm39) critical splice donor site probably null
R2030:Hr UTSW 14 70,808,888 (GRCm39) missense probably damaging 1.00
R2266:Hr UTSW 14 70,795,547 (GRCm39) missense probably benign
R2267:Hr UTSW 14 70,795,547 (GRCm39) missense probably benign
R2268:Hr UTSW 14 70,795,547 (GRCm39) missense probably benign
R2377:Hr UTSW 14 70,795,318 (GRCm39) missense probably damaging 1.00
R3686:Hr UTSW 14 70,795,236 (GRCm39) missense probably damaging 0.98
R3687:Hr UTSW 14 70,795,236 (GRCm39) missense probably damaging 0.98
R3754:Hr UTSW 14 70,805,264 (GRCm39) missense probably damaging 1.00
R3803:Hr UTSW 14 70,795,333 (GRCm39) missense probably benign 0.01
R3846:Hr UTSW 14 70,808,893 (GRCm39) missense probably damaging 1.00
R3977:Hr UTSW 14 70,801,024 (GRCm39) missense probably benign 0.01
R3978:Hr UTSW 14 70,801,024 (GRCm39) missense probably benign 0.01
R3979:Hr UTSW 14 70,801,024 (GRCm39) missense probably benign 0.01
R4528:Hr UTSW 14 70,803,823 (GRCm39) missense probably damaging 1.00
R4654:Hr UTSW 14 70,801,013 (GRCm39) missense probably damaging 0.99
R4834:Hr UTSW 14 70,797,362 (GRCm39) missense probably damaging 0.98
R4847:Hr UTSW 14 70,793,916 (GRCm39) missense probably benign 0.04
R4863:Hr UTSW 14 70,809,412 (GRCm39) missense probably damaging 1.00
R5292:Hr UTSW 14 70,809,432 (GRCm39) missense probably damaging 1.00
R5452:Hr UTSW 14 70,794,067 (GRCm39) missense probably damaging 1.00
R5717:Hr UTSW 14 70,803,616 (GRCm39) missense probably benign 0.34
R5902:Hr UTSW 14 70,795,231 (GRCm39) missense probably benign 0.02
R6000:Hr UTSW 14 70,805,273 (GRCm39) missense probably damaging 0.97
R6439:Hr UTSW 14 70,799,276 (GRCm39) missense possibly damaging 0.89
R6823:Hr UTSW 14 70,802,814 (GRCm39) missense probably damaging 0.98
R7030:Hr UTSW 14 70,801,124 (GRCm39) critical splice donor site probably null
R7213:Hr UTSW 14 70,795,790 (GRCm39) missense probably damaging 0.99
R7452:Hr UTSW 14 70,808,926 (GRCm39) missense probably damaging 1.00
R7468:Hr UTSW 14 70,795,652 (GRCm39) missense possibly damaging 0.89
R7572:Hr UTSW 14 70,799,293 (GRCm39) missense possibly damaging 0.66
R7956:Hr UTSW 14 70,797,327 (GRCm39) missense probably benign
R7996:Hr UTSW 14 70,801,043 (GRCm39) nonsense probably null
R7997:Hr UTSW 14 70,801,043 (GRCm39) nonsense probably null
R8076:Hr UTSW 14 70,795,381 (GRCm39) missense probably benign 0.00
R8101:Hr UTSW 14 70,805,282 (GRCm39) missense possibly damaging 0.67
R8553:Hr UTSW 14 70,804,965 (GRCm39) missense probably damaging 1.00
R8749:Hr UTSW 14 70,795,510 (GRCm39) missense probably damaging 1.00
R8850:Hr UTSW 14 70,799,305 (GRCm39) nonsense probably null
R8949:Hr UTSW 14 70,795,328 (GRCm39) missense probably benign 0.01
R9139:Hr UTSW 14 70,795,079 (GRCm39) missense possibly damaging 0.65
R9236:Hr UTSW 14 70,809,396 (GRCm39) missense probably damaging 1.00
R9246:Hr UTSW 14 70,808,915 (GRCm39) missense probably damaging 1.00
R9327:Hr UTSW 14 70,805,228 (GRCm39) missense possibly damaging 0.91
R9487:Hr UTSW 14 70,794,205 (GRCm39) missense possibly damaging 0.77
R9487:Hr UTSW 14 70,793,877 (GRCm39) missense probably benign 0.01
R9700:Hr UTSW 14 70,804,616 (GRCm39) missense probably benign 0.00
X0025:Hr UTSW 14 70,804,391 (GRCm39) splice site probably null
X0026:Hr UTSW 14 70,805,281 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACATCCTGCCAGCATCACTTAG -3'
(R):5'- CCACAAGGGAAATTGGCTCAC -3'

Sequencing Primer
(F):5'- AGCATCACTTAGCAGGTGTC -3'
(R):5'- AAGGGAAATTGGCTCACCTTCTC -3'
Posted On 2022-04-18