Mutagenetix > Incidental Mutation

Incidental Mutation 'R9337:Hr'

707266

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000022096

Gene Name

hairless

Synonyms

ALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9337 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70552212-70573548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70559884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 519 (E519V)

Ref Sequence

ENSEMBL: ENSMUSP00000124816 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]

AlphaFold

Q61645

Predicted Effect

probably benign
Transcript: ENSMUST00000022691
AA Change: E519V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: E519V

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161069
AA Change: E519V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: E519V

Domain	Start	End	E-Value	Type
Blast:JmjC	54	849	N/A	BLAST
JmjC	939	1150	5.23e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163060
AA Change: E548V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: E548V

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
Blast:JmjC	83	878	N/A	BLAST
JmjC	968	1179	5.23e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,090,113	T22A	possibly damaging	Het
Adad1	T	C	3: 37,085,098	V439A	possibly damaging	Het
Ahnak	G	A	19: 9,012,460		probably benign	Het
Arhgef10l	G	A	4: 140,611,313	T46I	probably damaging	Het
BC022687	T	C	12: 112,812,278	L218P	probably damaging	Het
C3ar1	A	G	6: 122,850,319	V313A	probably benign	Het
Capn13	T	A	17: 73,326,472		probably null	Het
Ccdc30	T	A	4: 119,333,723		probably null	Het
Ccdc7a	T	C	8: 128,889,838	Q928R	probably benign	Het
Cept1	A	G	3: 106,505,259	L299S	possibly damaging	Het
Cnot1	T	C	8: 95,741,820	I1460M	probably damaging	Het
Col4a2	T	C	8: 11,429,346	L743P	probably benign	Het
Cop1	T	C	1: 159,244,651	V179A	probably benign	Het
Cpvl	A	G	6: 53,932,494	I219T	probably damaging	Het
Cyc1	T	C	15: 76,344,306	V45A	probably benign	Het
Dnhd1	T	A	7: 105,720,599	N4410K	probably benign	Het
Dok4	T	A	8: 94,866,841	T106S	probably benign	Het
Exosc10	T	C	4: 148,581,131	F842L	probably damaging	Het
Fam24b	T	A	7: 131,326,220	Y80F	probably benign	Het
Fbn2	G	A	18: 58,209,651	A52V	probably benign	Het
Gal3st3	A	T	19: 5,306,840	N81I	probably damaging	Het
Gm13283	T	A	4: 88,760,799	V9E	possibly damaging	Het
Gm17026	A	G	14: 42,258,916	S58P		Het
Grm8	A	T	6: 27,761,215	S337T	probably benign	Het
Hdac5	G	A	11: 102,205,352	P332S	probably damaging	Het
Hspbap1	A	G	16: 35,825,025	H360R	probably benign	Het
Iqgap3	T	G	3: 88,116,118		probably null	Het
Krtap5-3	T	A	7: 142,202,530	H175Q	unknown	Het
Lrrn4	A	T	2: 132,870,632	S424T	probably benign	Het
Lsm10	C	A	4: 126,097,867	H5Q	probably damaging	Het
Megf10	A	T	18: 57,261,180	K459*	probably null	Het
Myo15b	A	C	11: 115,859,035	K210N		Het
Olfr1085	T	C	2: 86,658,132	T109A	probably benign	Het
Olfr1126	T	A	2: 87,457,183	I6N	probably benign	Het
Park7	A	T	4: 150,907,096	C46S	probably damaging	Het
Pik3cb	A	G	9: 99,061,791	F653S	probably damaging	Het
Plekha1	T	A	7: 130,909,618	C311S	possibly damaging	Het
Pprc1	T	A	19: 46,063,759	M576K	unknown	Het
Prelid3b	G	A	2: 174,468,368	T74M	probably benign	Het
Prg4	T	C	1: 150,451,365	Y311C	probably damaging	Het
Prom2	A	C	2: 127,529,174	V801G	probably damaging	Het
Psmd9	T	A	5: 123,248,324	V44D	probably damaging	Het
Ptpn3	C	G	4: 57,218,521	L647F	probably damaging	Het
Ptprj	T	C	2: 90,439,894	D1286G	probably damaging	Het
Rcc2	T	C	4: 140,718,378	I449T	probably damaging	Het
Rev3l	A	T	10: 39,822,854	S1116C	probably benign	Het
Rnf212	A	T	5: 108,774,889	S32T	possibly damaging	Het
Rnf40	T	A	7: 127,589,000	S2T	probably benign	Het
Rrp8	T	C	7: 105,734,177	D294G	probably damaging	Het
Rtf2	A	T	2: 172,466,285	K201N	probably damaging	Het
Runx3	A	G	4: 135,163,263	T173A	probably damaging	Het
Sardh	T	C	2: 27,196,666	I827M	probably benign	Het
Sec22b	T	C	3: 97,921,178	Y186H	probably benign	Het
Serpina5	C	T	12: 104,105,283	T383I	possibly damaging	Het
Slc12a2	A	G	18: 57,930,166	D906G	probably damaging	Het
Socs1	T	C	16: 10,784,714	D53G	possibly damaging	Het
Stat1	G	T	1: 52,152,270	A595S	probably benign	Het
Stat3	A	T	11: 100,907,989		probably null	Het
Styxl1	T	C	5: 135,765,738	S82G	probably benign	Het
Taf1b	T	A	12: 24,547,122	D353E	possibly damaging	Het
Tbce	T	C	13: 14,019,813	K87R	probably benign	Het
Thada	T	C	17: 84,441,777	M589V	probably benign	Het
Them5	A	G	3: 94,346,741	M257V	unknown	Het
Tln1	A	T	4: 43,532,927	I2425N	probably damaging	Het
Tuba8	A	G	6: 121,225,864	S379G	probably damaging	Het
Vrk1	T	C	12: 106,058,698		probably null	Het
Zbtb34	T	C	2: 33,411,704	Y275C	probably damaging	Het
Zcwpw1	T	C	5: 137,801,012	C214R	probably benign	Het
Zeb2	A	G	2: 45,022,900	V137A	probably benign	Het

Other mutations in Hr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01805:Hr	APN	14	70565297	splice site	probably benign
IGL02020:Hr	APN	14	70556437	missense	probably benign	0.01
IGL02372:Hr	APN	14	70558350	missense	possibly damaging	0.94
IGL02380:Hr	APN	14	70557761	missense	probably damaging	0.98
IGL02554:Hr	APN	14	70559866	splice site	probably benign
IGL02949:Hr	APN	14	70559785	missense	possibly damaging	0.87
IGL03406:Hr	APN	14	70563420	critical splice donor site	probably null
angie	UTSW	14	70567833	missense	probably damaging	0.97
blofeld	UTSW	14	70568085	missense	probably damaging	1.00
general	UTSW	14	70563684	critical splice donor site	probably null
kaburo	UTSW	14		unclassified
mister_clean	UTSW	14	70560064	critical splice donor site	probably benign
mushroom	UTSW	14	70568085	missense	probably damaging	1.00
prune	UTSW	14	70571429	missense	probably damaging	1.00
ren	UTSW	14	70568085	missense	probably damaging	1.00
subclinical	UTSW	14	70561836	missense	possibly damaging	0.89
vessel	UTSW	14	70561865	nonsense	probably null
yuanxiao	UTSW	14	70571448	missense	probably damaging	1.00
R0018:Hr	UTSW	14	70558277	missense	probably benign
R0038:Hr	UTSW	14	70568085	missense	probably damaging	1.00
R0374:Hr	UTSW	14	70556476	missense	probably benign	0.01
R0511:Hr	UTSW	14	70561912	nonsense	probably null
R0609:Hr	UTSW	14	70559657	missense	probably benign
R1828:Hr	UTSW	14	70572037	critical splice donor site	probably null
R2030:Hr	UTSW	14	70571448	missense	probably damaging	1.00
R2266:Hr	UTSW	14	70558107	missense	probably benign
R2267:Hr	UTSW	14	70558107	missense	probably benign
R2268:Hr	UTSW	14	70558107	missense	probably benign
R2377:Hr	UTSW	14	70557878	missense	probably damaging	1.00
R3686:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3687:Hr	UTSW	14	70557796	missense	probably damaging	0.98
R3754:Hr	UTSW	14	70567824	missense	probably damaging	1.00
R3803:Hr	UTSW	14	70557893	missense	probably benign	0.01
R3846:Hr	UTSW	14	70571453	missense	probably damaging	1.00
R3977:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3978:Hr	UTSW	14	70563584	missense	probably benign	0.01
R3979:Hr	UTSW	14	70563584	missense	probably benign	0.01
R4528:Hr	UTSW	14	70566383	missense	probably damaging	1.00
R4654:Hr	UTSW	14	70563573	missense	probably damaging	0.99
R4834:Hr	UTSW	14	70559922	missense	probably damaging	0.98
R4847:Hr	UTSW	14	70556476	missense	probably benign	0.04
R4863:Hr	UTSW	14	70571972	missense	probably damaging	1.00
R5292:Hr	UTSW	14	70571992	missense	probably damaging	1.00
R5452:Hr	UTSW	14	70556627	missense	probably damaging	1.00
R5717:Hr	UTSW	14	70566176	missense	probably benign	0.34
R5902:Hr	UTSW	14	70557791	missense	probably benign	0.02
R6000:Hr	UTSW	14	70567833	missense	probably damaging	0.97
R6439:Hr	UTSW	14	70561836	missense	possibly damaging	0.89
R6823:Hr	UTSW	14	70565374	missense	probably damaging	0.98
R7030:Hr	UTSW	14	70563684	critical splice donor site	probably null
R7213:Hr	UTSW	14	70558350	missense	probably damaging	0.99
R7452:Hr	UTSW	14	70571486	missense	probably damaging	1.00
R7468:Hr	UTSW	14	70558212	missense	possibly damaging	0.89
R7572:Hr	UTSW	14	70561853	missense	possibly damaging	0.66
R7956:Hr	UTSW	14	70559887	missense	probably benign
R7996:Hr	UTSW	14	70563603	nonsense	probably null
R7997:Hr	UTSW	14	70563603	nonsense	probably null
R8076:Hr	UTSW	14	70557941	missense	probably benign	0.00
R8101:Hr	UTSW	14	70567842	missense	possibly damaging	0.67
R8553:Hr	UTSW	14	70567525	missense	probably damaging	1.00
R8749:Hr	UTSW	14	70558070	missense	probably damaging	1.00
R8850:Hr	UTSW	14	70561865	nonsense	probably null
R8949:Hr	UTSW	14	70557888	missense	probably benign	0.01
R9139:Hr	UTSW	14	70557639	missense	possibly damaging	0.65
R9236:Hr	UTSW	14	70571956	missense	probably damaging	1.00
R9246:Hr	UTSW	14	70571475	missense	probably damaging	1.00
R9327:Hr	UTSW	14	70567788	missense	possibly damaging	0.91
R9487:Hr	UTSW	14	70556437	missense	probably benign	0.01
R9487:Hr	UTSW	14	70556765	missense	possibly damaging	0.77
R9700:Hr	UTSW	14	70567176	missense	probably benign	0.00
X0025:Hr	UTSW	14	70566951	splice site	probably null
X0026:Hr	UTSW	14	70567841	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TACATCCTGCCAGCATCACTTAG -3'
(R):5'- CCACAAGGGAAATTGGCTCAC -3'

Sequencing Primer
(F):5'- AGCATCACTTAGCAGGTGTC -3'
(R):5'- AAGGGAAATTGGCTCACCTTCTC -3'

Posted On

2022-04-18