Incidental Mutation 'R9337:Megf10'
ID 707272
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 57261180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 459 (K459*)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably null
Transcript: ENSMUST00000075770
AA Change: K459*
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: K459*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139892
AA Change: K459*
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: K459*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.9757 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adad1 T C 3: 37,085,098 V439A possibly damaging Het
Ahnak G A 19: 9,012,460 probably benign Het
Arhgef10l G A 4: 140,611,313 T46I probably damaging Het
BC022687 T C 12: 112,812,278 L218P probably damaging Het
C3ar1 A G 6: 122,850,319 V313A probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Ccdc30 T A 4: 119,333,723 probably null Het
Ccdc7a T C 8: 128,889,838 Q928R probably benign Het
Cept1 A G 3: 106,505,259 L299S possibly damaging Het
Cnot1 T C 8: 95,741,820 I1460M probably damaging Het
Col4a2 T C 8: 11,429,346 L743P probably benign Het
Cop1 T C 1: 159,244,651 V179A probably benign Het
Cpvl A G 6: 53,932,494 I219T probably damaging Het
Cyc1 T C 15: 76,344,306 V45A probably benign Het
Dnhd1 T A 7: 105,720,599 N4410K probably benign Het
Dok4 T A 8: 94,866,841 T106S probably benign Het
Exosc10 T C 4: 148,581,131 F842L probably damaging Het
Fam24b T A 7: 131,326,220 Y80F probably benign Het
Fbn2 G A 18: 58,209,651 A52V probably benign Het
Gal3st3 A T 19: 5,306,840 N81I probably damaging Het
Gm13283 T A 4: 88,760,799 V9E possibly damaging Het
Gm17026 A G 14: 42,258,916 S58P Het
Grm8 A T 6: 27,761,215 S337T probably benign Het
Hdac5 G A 11: 102,205,352 P332S probably damaging Het
Hr A T 14: 70,559,884 E519V probably benign Het
Hspbap1 A G 16: 35,825,025 H360R probably benign Het
Iqgap3 T G 3: 88,116,118 probably null Het
Krtap5-3 T A 7: 142,202,530 H175Q unknown Het
Lrrn4 A T 2: 132,870,632 S424T probably benign Het
Lsm10 C A 4: 126,097,867 H5Q probably damaging Het
Myo15b A C 11: 115,859,035 K210N Het
Olfr1085 T C 2: 86,658,132 T109A probably benign Het
Olfr1126 T A 2: 87,457,183 I6N probably benign Het
Park7 A T 4: 150,907,096 C46S probably damaging Het
Pik3cb A G 9: 99,061,791 F653S probably damaging Het
Plekha1 T A 7: 130,909,618 C311S possibly damaging Het
Pprc1 T A 19: 46,063,759 M576K unknown Het
Prelid3b G A 2: 174,468,368 T74M probably benign Het
Prg4 T C 1: 150,451,365 Y311C probably damaging Het
Prom2 A C 2: 127,529,174 V801G probably damaging Het
Psmd9 T A 5: 123,248,324 V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 L647F probably damaging Het
Ptprj T C 2: 90,439,894 D1286G probably damaging Het
Rcc2 T C 4: 140,718,378 I449T probably damaging Het
Rev3l A T 10: 39,822,854 S1116C probably benign Het
Rnf212 A T 5: 108,774,889 S32T possibly damaging Het
Rnf40 T A 7: 127,589,000 S2T probably benign Het
Rrp8 T C 7: 105,734,177 D294G probably damaging Het
Rtf2 A T 2: 172,466,285 K201N probably damaging Het
Runx3 A G 4: 135,163,263 T173A probably damaging Het
Sardh T C 2: 27,196,666 I827M probably benign Het
Sec22b T C 3: 97,921,178 Y186H probably benign Het
Serpina5 C T 12: 104,105,283 T383I possibly damaging Het
Slc12a2 A G 18: 57,930,166 D906G probably damaging Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Stat1 G T 1: 52,152,270 A595S probably benign Het
Stat3 A T 11: 100,907,989 probably null Het
Styxl1 T C 5: 135,765,738 S82G probably benign Het
Taf1b T A 12: 24,547,122 D353E possibly damaging Het
Tbce T C 13: 14,019,813 K87R probably benign Het
Thada T C 17: 84,441,777 M589V probably benign Het
Them5 A G 3: 94,346,741 M257V unknown Het
Tln1 A T 4: 43,532,927 I2425N probably damaging Het
Tuba8 A G 6: 121,225,864 S379G probably damaging Het
Vrk1 T C 12: 106,058,698 probably null Het
Zbtb34 T C 2: 33,411,704 Y275C probably damaging Het
Zcwpw1 T C 5: 137,801,012 C214R probably benign Het
Zeb2 A G 2: 45,022,900 V137A probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9117:Megf10 UTSW 18 57259701 missense probably damaging 1.00
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
R9644:Megf10 UTSW 18 57242701 missense probably benign
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTGCACCTGAGTCTCCAC -3'
(R):5'- GATGCTGAGGCCATCATTTTATG -3'

Sequencing Primer
(F):5'- TGAGTCTCCACAACTTGCATAG -3'
(R):5'- TCACAGGCACACTCTTAC -3'
Posted On 2022-04-18