Incidental Mutation 'R9337:Slc12a2'
ID 707273
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Name solute carrier family 12, member 2
Synonyms Nkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 57878678-57946821 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57930166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 906 (D906G)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000115366
AA Change: D906G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: D906G

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Meta Mutation Damage Score 0.7735 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adad1 T C 3: 37,085,098 V439A possibly damaging Het
Ahnak G A 19: 9,012,460 probably benign Het
Arhgef10l G A 4: 140,611,313 T46I probably damaging Het
BC022687 T C 12: 112,812,278 L218P probably damaging Het
C3ar1 A G 6: 122,850,319 V313A probably benign Het
Capn13 T A 17: 73,326,472 probably null Het
Ccdc30 T A 4: 119,333,723 probably null Het
Ccdc7a T C 8: 128,889,838 Q928R probably benign Het
Cept1 A G 3: 106,505,259 L299S possibly damaging Het
Cnot1 T C 8: 95,741,820 I1460M probably damaging Het
Col4a2 T C 8: 11,429,346 L743P probably benign Het
Cop1 T C 1: 159,244,651 V179A probably benign Het
Cpvl A G 6: 53,932,494 I219T probably damaging Het
Cyc1 T C 15: 76,344,306 V45A probably benign Het
Dnhd1 T A 7: 105,720,599 N4410K probably benign Het
Dok4 T A 8: 94,866,841 T106S probably benign Het
Exosc10 T C 4: 148,581,131 F842L probably damaging Het
Fam24b T A 7: 131,326,220 Y80F probably benign Het
Fbn2 G A 18: 58,209,651 A52V probably benign Het
Gal3st3 A T 19: 5,306,840 N81I probably damaging Het
Gm13283 T A 4: 88,760,799 V9E possibly damaging Het
Gm17026 A G 14: 42,258,916 S58P Het
Grm8 A T 6: 27,761,215 S337T probably benign Het
Hdac5 G A 11: 102,205,352 P332S probably damaging Het
Hr A T 14: 70,559,884 E519V probably benign Het
Hspbap1 A G 16: 35,825,025 H360R probably benign Het
Iqgap3 T G 3: 88,116,118 probably null Het
Krtap5-3 T A 7: 142,202,530 H175Q unknown Het
Lrrn4 A T 2: 132,870,632 S424T probably benign Het
Lsm10 C A 4: 126,097,867 H5Q probably damaging Het
Megf10 A T 18: 57,261,180 K459* probably null Het
Myo15b A C 11: 115,859,035 K210N Het
Olfr1085 T C 2: 86,658,132 T109A probably benign Het
Olfr1126 T A 2: 87,457,183 I6N probably benign Het
Park7 A T 4: 150,907,096 C46S probably damaging Het
Pik3cb A G 9: 99,061,791 F653S probably damaging Het
Plekha1 T A 7: 130,909,618 C311S possibly damaging Het
Pprc1 T A 19: 46,063,759 M576K unknown Het
Prelid3b G A 2: 174,468,368 T74M probably benign Het
Prg4 T C 1: 150,451,365 Y311C probably damaging Het
Prom2 A C 2: 127,529,174 V801G probably damaging Het
Psmd9 T A 5: 123,248,324 V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 L647F probably damaging Het
Ptprj T C 2: 90,439,894 D1286G probably damaging Het
Rcc2 T C 4: 140,718,378 I449T probably damaging Het
Rev3l A T 10: 39,822,854 S1116C probably benign Het
Rnf212 A T 5: 108,774,889 S32T possibly damaging Het
Rnf40 T A 7: 127,589,000 S2T probably benign Het
Rrp8 T C 7: 105,734,177 D294G probably damaging Het
Rtf2 A T 2: 172,466,285 K201N probably damaging Het
Runx3 A G 4: 135,163,263 T173A probably damaging Het
Sardh T C 2: 27,196,666 I827M probably benign Het
Sec22b T C 3: 97,921,178 Y186H probably benign Het
Serpina5 C T 12: 104,105,283 T383I possibly damaging Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
Stat1 G T 1: 52,152,270 A595S probably benign Het
Stat3 A T 11: 100,907,989 probably null Het
Styxl1 T C 5: 135,765,738 S82G probably benign Het
Taf1b T A 12: 24,547,122 D353E possibly damaging Het
Tbce T C 13: 14,019,813 K87R probably benign Het
Thada T C 17: 84,441,777 M589V probably benign Het
Them5 A G 3: 94,346,741 M257V unknown Het
Tln1 A T 4: 43,532,927 I2425N probably damaging Het
Tuba8 A G 6: 121,225,864 S379G probably damaging Het
Vrk1 T C 12: 106,058,698 probably null Het
Zbtb34 T C 2: 33,411,704 Y275C probably damaging Het
Zcwpw1 T C 5: 137,801,012 C214R probably benign Het
Zeb2 A G 2: 45,022,900 V137A probably benign Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
honeylamb UTSW 18 57930166 missense probably damaging 1.00
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 57900050 missense probably benign 0.03
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 57910256 missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 57912965 splice site probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 57896354 missense probably benign 0.01
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
R7411:Slc12a2 UTSW 18 57941013 missense probably benign 0.01
R7508:Slc12a2 UTSW 18 57904393 missense probably benign 0.01
R7645:Slc12a2 UTSW 18 57896378 missense possibly damaging 0.94
R7658:Slc12a2 UTSW 18 57932524 missense probably benign 0.02
R8054:Slc12a2 UTSW 18 57921872 nonsense probably null
R8093:Slc12a2 UTSW 18 57879351 missense probably benign 0.17
R8099:Slc12a2 UTSW 18 57899392 missense probably damaging 0.99
R8121:Slc12a2 UTSW 18 57899331 missense probably benign 0.44
R8214:Slc12a2 UTSW 18 57937719 missense probably benign 0.29
R8273:Slc12a2 UTSW 18 57914266 splice site probably benign
R8341:Slc12a2 UTSW 18 57879209 missense possibly damaging 0.48
R8485:Slc12a2 UTSW 18 57941146 critical splice donor site probably null
R8797:Slc12a2 UTSW 18 57879383 missense possibly damaging 0.80
R9049:Slc12a2 UTSW 18 57921791 nonsense probably null
R9180:Slc12a2 UTSW 18 57936397 missense possibly damaging 0.83
R9256:Slc12a2 UTSW 18 57941795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGATTAGGACCTAACATG -3'
(R):5'- ATTAGGCACAACTTTCTAACCAAG -3'

Sequencing Primer
(F):5'- GGGATTAGGACCTAACATGATTCATC -3'
(R):5'- CATGGCTCTAGCTGCACATGTAG -3'
Posted On 2022-04-18