Incidental Mutation 'R9337:Ahnak'
ID 707276
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene Name AHNAK nucleoprotein
Synonyms DY6, 1110004P15Rik, 2310047C17Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R9337 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8966648-9054278 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to A at 8989824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000092956
AA Change: V3703M
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: V3703M

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Meta Mutation Damage Score 0.1131 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adad1 T C 3: 37,139,247 (GRCm39) V439A possibly damaging Het
Arhgef10l G A 4: 140,338,624 (GRCm39) T46I probably damaging Het
C3ar1 A G 6: 122,827,278 (GRCm39) V313A probably benign Het
Capn13 T A 17: 73,633,467 (GRCm39) probably null Het
Ccdc30 T A 4: 119,190,920 (GRCm39) probably null Het
Ccdc7a T C 8: 129,616,319 (GRCm39) Q928R probably benign Het
Cept1 A G 3: 106,412,575 (GRCm39) L299S possibly damaging Het
Clba1 T C 12: 112,775,898 (GRCm39) L218P probably damaging Het
Cnot1 T C 8: 96,468,448 (GRCm39) I1460M probably damaging Het
Col4a2 T C 8: 11,479,346 (GRCm39) L743P probably benign Het
Cop1 T C 1: 159,072,221 (GRCm39) V179A probably benign Het
Cpvl A G 6: 53,909,479 (GRCm39) I219T probably damaging Het
Cyc1 T C 15: 76,228,506 (GRCm39) V45A probably benign Het
Dnhd1 T A 7: 105,369,806 (GRCm39) N4410K probably benign Het
Dok4 T A 8: 95,593,469 (GRCm39) T106S probably benign Het
Exosc10 T C 4: 148,665,588 (GRCm39) F842L probably damaging Het
Fam24b T A 7: 130,927,949 (GRCm39) Y80F probably benign Het
Fbn2 G A 18: 58,342,723 (GRCm39) A52V probably benign Het
Gal3st3 A T 19: 5,356,868 (GRCm39) N81I probably damaging Het
Gm13283 T A 4: 88,679,036 (GRCm39) V9E possibly damaging Het
Gm17026 A G 14: 42,080,873 (GRCm39) S58P Het
Grm8 A T 6: 27,761,214 (GRCm39) S337T probably benign Het
Hdac5 G A 11: 102,096,178 (GRCm39) P332S probably damaging Het
Hr A T 14: 70,797,324 (GRCm39) E519V probably benign Het
Hspbap1 A G 16: 35,645,395 (GRCm39) H360R probably benign Het
Iqgap3 T G 3: 88,023,425 (GRCm39) probably null Het
Krtap5-3 T A 7: 141,756,267 (GRCm39) H175Q unknown Het
Lrrn4 A T 2: 132,712,552 (GRCm39) S424T probably benign Het
Lsm10 C A 4: 125,991,660 (GRCm39) H5Q probably damaging Het
Megf10 A T 18: 57,394,252 (GRCm39) K459* probably null Het
Myo15b A C 11: 115,749,861 (GRCm39) K210N Het
Or12e7 T A 2: 87,287,527 (GRCm39) I6N probably benign Het
Or8k38 T C 2: 86,488,476 (GRCm39) T109A probably benign Het
Park7 A T 4: 150,991,553 (GRCm39) C46S probably damaging Het
Pik3cb A G 9: 98,943,844 (GRCm39) F653S probably damaging Het
Plekha1 T A 7: 130,511,348 (GRCm39) C311S possibly damaging Het
Pprc1 T A 19: 46,052,198 (GRCm39) M576K unknown Het
Prelid3b G A 2: 174,310,161 (GRCm39) T74M probably benign Het
Prg4 T C 1: 150,327,116 (GRCm39) Y311C probably damaging Het
Prom2 A C 2: 127,371,094 (GRCm39) V801G probably damaging Het
Psmd9 T A 5: 123,386,387 (GRCm39) V44D probably damaging Het
Ptpn3 C G 4: 57,218,521 (GRCm39) L647F probably damaging Het
Ptprj T C 2: 90,270,238 (GRCm39) D1286G probably damaging Het
Rcc2 T C 4: 140,445,689 (GRCm39) I449T probably damaging Het
Rev3l A T 10: 39,698,850 (GRCm39) S1116C probably benign Het
Rnf212 A T 5: 108,922,755 (GRCm39) S32T possibly damaging Het
Rnf40 T A 7: 127,188,172 (GRCm39) S2T probably benign Het
Rrp8 T C 7: 105,383,384 (GRCm39) D294G probably damaging Het
Rtf2 A T 2: 172,308,205 (GRCm39) K201N probably damaging Het
Runx3 A G 4: 134,890,574 (GRCm39) T173A probably damaging Het
Sardh T C 2: 27,086,678 (GRCm39) I827M probably benign Het
Sec22b T C 3: 97,828,494 (GRCm39) Y186H probably benign Het
Serpina5 C T 12: 104,071,542 (GRCm39) T383I possibly damaging Het
Slc12a2 A G 18: 58,063,238 (GRCm39) D906G probably damaging Het
Socs1 T C 16: 10,602,578 (GRCm39) D53G possibly damaging Het
Stat1 G T 1: 52,191,429 (GRCm39) A595S probably benign Het
Stat3 A T 11: 100,798,815 (GRCm39) probably null Het
Styxl1 T C 5: 135,794,592 (GRCm39) S82G probably benign Het
Taf1b T A 12: 24,597,121 (GRCm39) D353E possibly damaging Het
Tbce T C 13: 14,194,398 (GRCm39) K87R probably benign Het
Thada T C 17: 84,749,205 (GRCm39) M589V probably benign Het
Them5 A G 3: 94,254,048 (GRCm39) M257V unknown Het
Tln1 A T 4: 43,532,927 (GRCm39) I2425N probably damaging Het
Tuba8 A G 6: 121,202,823 (GRCm39) S379G probably damaging Het
Vrk1 T C 12: 106,024,957 (GRCm39) probably null Het
Zbtb34 T C 2: 33,301,716 (GRCm39) Y275C probably damaging Het
Zcwpw1 T C 5: 137,799,274 (GRCm39) C214R probably benign Het
Zeb2 A G 2: 44,912,912 (GRCm39) V137A probably benign Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 8,984,587 (GRCm39) missense probably damaging 0.99
IGL00509:Ahnak APN 19 8,987,315 (GRCm39) missense possibly damaging 0.94
IGL00539:Ahnak APN 19 8,985,272 (GRCm39) missense possibly damaging 0.50
IGL00558:Ahnak APN 19 8,981,671 (GRCm39) missense possibly damaging 0.93
IGL00567:Ahnak APN 19 8,990,747 (GRCm39) missense probably benign 0.24
IGL00706:Ahnak APN 19 8,991,094 (GRCm39) nonsense probably null
IGL00807:Ahnak APN 19 8,985,886 (GRCm39) missense possibly damaging 0.92
IGL00870:Ahnak APN 19 8,991,062 (GRCm39) missense probably damaging 1.00
IGL01101:Ahnak APN 19 8,990,251 (GRCm39) intron probably benign
IGL01118:Ahnak APN 19 8,989,942 (GRCm39) missense probably damaging 1.00
IGL01288:Ahnak APN 19 8,979,858 (GRCm39) missense possibly damaging 0.94
IGL01324:Ahnak APN 19 8,980,396 (GRCm39) missense probably damaging 1.00
IGL01341:Ahnak APN 19 8,989,067 (GRCm39) missense probably benign
IGL01541:Ahnak APN 19 8,985,243 (GRCm39) missense possibly damaging 0.95
IGL01580:Ahnak APN 19 8,980,203 (GRCm39) missense probably benign 0.02
IGL01595:Ahnak APN 19 8,980,865 (GRCm39) nonsense probably null
IGL01746:Ahnak APN 19 8,982,276 (GRCm39) missense possibly damaging 0.89
IGL01766:Ahnak APN 19 8,977,482 (GRCm39) missense unknown
IGL01821:Ahnak APN 19 8,989,482 (GRCm39) missense probably benign
IGL01913:Ahnak APN 19 8,983,428 (GRCm39) nonsense probably null
IGL01934:Ahnak APN 19 8,980,021 (GRCm39) missense probably damaging 1.00
IGL01940:Ahnak APN 19 8,983,921 (GRCm39) missense probably benign 0.14
IGL01958:Ahnak APN 19 8,992,273 (GRCm39) missense possibly damaging 0.59
IGL02145:Ahnak APN 19 8,980,219 (GRCm39) missense probably benign 0.11
IGL02246:Ahnak APN 19 8,985,632 (GRCm39) missense probably damaging 1.00
IGL02282:Ahnak APN 19 8,983,351 (GRCm39) missense probably damaging 1.00
IGL02428:Ahnak APN 19 8,992,197 (GRCm39) missense possibly damaging 0.83
IGL02442:Ahnak APN 19 8,981,380 (GRCm39) missense probably damaging 1.00
IGL02474:Ahnak APN 19 8,982,297 (GRCm39) missense probably benign 0.13
IGL02483:Ahnak APN 19 8,980,672 (GRCm39) missense probably benign 0.01
IGL02616:Ahnak APN 19 8,982,991 (GRCm39) missense probably benign 0.03
IGL02630:Ahnak APN 19 8,989,441 (GRCm39) missense probably damaging 1.00
IGL02690:Ahnak APN 19 8,989,948 (GRCm39) nonsense probably null
IGL02717:Ahnak APN 19 8,979,751 (GRCm39) missense probably benign 0.00
IGL02721:Ahnak APN 19 8,987,071 (GRCm39) missense probably benign 0.07
IGL02737:Ahnak APN 19 8,981,957 (GRCm39) missense probably benign 0.17
IGL02850:Ahnak APN 19 8,979,960 (GRCm39) missense probably benign 0.00
IGL03071:Ahnak APN 19 8,989,282 (GRCm39) missense possibly damaging 0.63
IGL03072:Ahnak APN 19 8,983,872 (GRCm39) missense probably benign 0.11
IGL03094:Ahnak APN 19 8,980,911 (GRCm39) missense possibly damaging 0.64
IGL03140:Ahnak APN 19 8,982,576 (GRCm39) intron probably benign
IGL03176:Ahnak APN 19 8,979,813 (GRCm39) missense probably damaging 1.00
IGL03176:Ahnak APN 19 8,985,530 (GRCm39) missense possibly damaging 0.56
IGL03189:Ahnak APN 19 8,988,603 (GRCm39) missense possibly damaging 0.65
IGL03357:Ahnak APN 19 8,986,689 (GRCm39) intron probably benign
IGL03371:Ahnak APN 19 8,981,592 (GRCm39) missense possibly damaging 0.91
Eskimo UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
Nanook UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
Netsilik UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
IGL03097:Ahnak UTSW 19 8,979,751 (GRCm39) missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 8,983,540 (GRCm39) missense possibly damaging 0.87
R0054:Ahnak UTSW 19 8,989,420 (GRCm39) missense probably damaging 1.00
R0094:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R0110:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0141:Ahnak UTSW 19 8,984,044 (GRCm39) missense probably damaging 1.00
R0166:Ahnak UTSW 19 8,983,089 (GRCm39) missense probably damaging 1.00
R0309:Ahnak UTSW 19 8,979,859 (GRCm39) missense probably damaging 1.00
R0368:Ahnak UTSW 19 8,985,714 (GRCm39) nonsense probably null
R0386:Ahnak UTSW 19 8,988,508 (GRCm39) missense possibly damaging 0.94
R0401:Ahnak UTSW 19 8,992,480 (GRCm39) missense probably benign 0.24
R0415:Ahnak UTSW 19 8,990,235 (GRCm39) intron probably benign
R0463:Ahnak UTSW 19 8,986,771 (GRCm39) intron probably benign
R0469:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0470:Ahnak UTSW 19 8,986,331 (GRCm39) missense probably benign 0.29
R0487:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R0487:Ahnak UTSW 19 8,984,515 (GRCm39) missense probably benign 0.00
R0499:Ahnak UTSW 19 8,977,628 (GRCm39) splice site probably benign
R0506:Ahnak UTSW 19 8,986,492 (GRCm39) missense probably damaging 1.00
R0510:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0557:Ahnak UTSW 19 8,979,308 (GRCm39) missense probably benign 0.10
R0570:Ahnak UTSW 19 8,991,062 (GRCm39) missense probably damaging 1.00
R0610:Ahnak UTSW 19 8,985,242 (GRCm39) missense probably benign 0.08
R0646:Ahnak UTSW 19 8,990,766 (GRCm39) nonsense probably null
R0659:Ahnak UTSW 19 8,992,366 (GRCm39) missense possibly damaging 0.60
R0791:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0792:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0840:Ahnak UTSW 19 8,982,427 (GRCm39) missense probably damaging 1.00
R0847:Ahnak UTSW 19 8,983,797 (GRCm39) nonsense probably null
R0941:Ahnak UTSW 19 8,987,278 (GRCm39) missense probably damaging 1.00
R0962:Ahnak UTSW 19 8,990,212 (GRCm39) intron probably benign
R1017:Ahnak UTSW 19 8,987,907 (GRCm39) missense probably damaging 0.99
R1037:Ahnak UTSW 19 8,984,982 (GRCm39) missense probably benign 0.27
R1085:Ahnak UTSW 19 8,990,489 (GRCm39) missense possibly damaging 0.50
R1113:Ahnak UTSW 19 8,982,984 (GRCm39) missense probably benign 0.29
R1140:Ahnak UTSW 19 8,981,609 (GRCm39) missense probably damaging 1.00
R1158:Ahnak UTSW 19 8,991,290 (GRCm39) missense probably benign 0.00
R1218:Ahnak UTSW 19 8,992,983 (GRCm39) missense probably damaging 1.00
R1225:Ahnak UTSW 19 8,980,247 (GRCm39) missense probably damaging 1.00
R1245:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R1421:Ahnak UTSW 19 8,992,995 (GRCm39) missense possibly damaging 0.95
R1447:Ahnak UTSW 19 8,984,446 (GRCm39) missense probably damaging 0.98
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1471:Ahnak UTSW 19 8,990,296 (GRCm39) intron probably benign
R1507:Ahnak UTSW 19 8,987,441 (GRCm39) missense probably damaging 1.00
R1521:Ahnak UTSW 19 8,982,092 (GRCm39) missense probably benign 0.11
R1568:Ahnak UTSW 19 8,979,739 (GRCm39) missense probably damaging 0.98
R1569:Ahnak UTSW 19 8,981,458 (GRCm39) missense possibly damaging 0.78
R1616:Ahnak UTSW 19 8,986,351 (GRCm39) missense possibly damaging 0.94
R1638:Ahnak UTSW 19 8,986,813 (GRCm39) missense probably benign 0.01
R1680:Ahnak UTSW 19 8,987,327 (GRCm39) missense probably benign 0.05
R1713:Ahnak UTSW 19 8,989,173 (GRCm39) missense possibly damaging 0.95
R1722:Ahnak UTSW 19 8,988,019 (GRCm39) missense probably damaging 0.99
R1771:Ahnak UTSW 19 8,991,117 (GRCm39) missense probably benign 0.24
R1795:Ahnak UTSW 19 8,979,802 (GRCm39) missense possibly damaging 0.79
R1823:Ahnak UTSW 19 8,982,269 (GRCm39) missense probably damaging 0.99
R1842:Ahnak UTSW 19 8,983,231 (GRCm39) missense probably damaging 0.99
R1854:Ahnak UTSW 19 8,991,196 (GRCm39) missense possibly damaging 0.61
R1856:Ahnak UTSW 19 8,979,412 (GRCm39) missense possibly damaging 0.86
R1886:Ahnak UTSW 19 8,993,343 (GRCm39) missense probably damaging 0.98
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1912:Ahnak UTSW 19 8,995,245 (GRCm39) missense probably damaging 1.00
R1913:Ahnak UTSW 19 8,985,286 (GRCm39) missense probably damaging 0.99
R1942:Ahnak UTSW 19 8,992,447 (GRCm39) missense probably damaging 0.98
R1987:Ahnak UTSW 19 8,992,615 (GRCm39) missense probably damaging 1.00
R2006:Ahnak UTSW 19 8,984,439 (GRCm39) missense probably damaging 1.00
R2013:Ahnak UTSW 19 8,991,937 (GRCm39) missense probably damaging 0.98
R2014:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R2047:Ahnak UTSW 19 8,991,664 (GRCm39) missense possibly damaging 0.67
R2048:Ahnak UTSW 19 8,984,420 (GRCm39) missense probably damaging 0.99
R2060:Ahnak UTSW 19 8,985,405 (GRCm39) missense probably benign 0.08
R2083:Ahnak UTSW 19 8,988,921 (GRCm39) missense probably damaging 1.00
R2157:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R2167:Ahnak UTSW 19 8,988,858 (GRCm39) nonsense probably null
R2208:Ahnak UTSW 19 8,995,096 (GRCm39) missense probably benign 0.00
R2224:Ahnak UTSW 19 8,990,355 (GRCm39) intron probably benign
R2268:Ahnak UTSW 19 8,987,938 (GRCm39) missense possibly damaging 0.66
R2420:Ahnak UTSW 19 8,986,620 (GRCm39) missense possibly damaging 0.89
R2426:Ahnak UTSW 19 8,980,215 (GRCm39) missense possibly damaging 0.81
R2910:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2911:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2981:Ahnak UTSW 19 8,977,512 (GRCm39) missense probably damaging 0.97
R3151:Ahnak UTSW 19 8,987,308 (GRCm39) missense probably benign 0.12
R3155:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R3422:Ahnak UTSW 19 8,984,116 (GRCm39) missense probably benign 0.05
R3422:Ahnak UTSW 19 8,983,072 (GRCm39) missense probably benign 0.39
R3430:Ahnak UTSW 19 8,984,322 (GRCm39) missense probably benign 0.42
R3433:Ahnak UTSW 19 8,987,358 (GRCm39) missense probably benign 0.01
R3711:Ahnak UTSW 19 8,985,262 (GRCm39) missense probably benign
R3723:Ahnak UTSW 19 8,994,217 (GRCm39) missense possibly damaging 0.79
R3775:Ahnak UTSW 19 8,986,387 (GRCm39) missense possibly damaging 0.91
R3858:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3859:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3922:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3924:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3926:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R4026:Ahnak UTSW 19 8,988,663 (GRCm39) missense probably damaging 0.97
R4051:Ahnak UTSW 19 8,991,691 (GRCm39) missense probably damaging 1.00
R4209:Ahnak UTSW 19 8,979,964 (GRCm39) missense probably damaging 1.00
R4234:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R4237:Ahnak UTSW 19 8,979,147 (GRCm39) missense probably benign 0.02
R4285:Ahnak UTSW 19 8,994,203 (GRCm39) nonsense probably null
R4331:Ahnak UTSW 19 8,993,184 (GRCm39) missense probably damaging 1.00
R4342:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R4430:Ahnak UTSW 19 8,980,404 (GRCm39) missense probably benign 0.00
R4554:Ahnak UTSW 19 8,992,294 (GRCm39) missense probably damaging 1.00
R4602:Ahnak UTSW 19 8,988,189 (GRCm39) missense possibly damaging 0.66
R4612:Ahnak UTSW 19 8,981,088 (GRCm39) missense probably benign 0.44
R4655:Ahnak UTSW 19 8,986,065 (GRCm39) missense probably damaging 1.00
R4656:Ahnak UTSW 19 8,982,219 (GRCm39) missense possibly damaging 0.80
R4700:Ahnak UTSW 19 8,982,045 (GRCm39) missense probably benign 0.02
R4704:Ahnak UTSW 19 8,989,622 (GRCm39) intron probably benign
R4704:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R4705:Ahnak UTSW 19 8,994,270 (GRCm39) missense probably benign 0.07
R4707:Ahnak UTSW 19 8,994,099 (GRCm39) missense probably benign 0.03
R4732:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4733:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4778:Ahnak UTSW 19 8,989,339 (GRCm39) missense possibly damaging 0.79
R4782:Ahnak UTSW 19 8,989,863 (GRCm39) intron probably benign
R4832:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R4882:Ahnak UTSW 19 8,983,261 (GRCm39) missense probably damaging 0.98
R4884:Ahnak UTSW 19 8,990,118 (GRCm39) intron probably benign
R4895:Ahnak UTSW 19 8,994,805 (GRCm39) missense probably benign 0.43
R4930:Ahnak UTSW 19 8,988,331 (GRCm39) missense possibly damaging 0.79
R4951:Ahnak UTSW 19 8,995,199 (GRCm39) missense probably damaging 1.00
R4968:Ahnak UTSW 19 8,992,464 (GRCm39) missense probably damaging 1.00
R5026:Ahnak UTSW 19 8,987,995 (GRCm39) missense possibly damaging 0.46
R5050:Ahnak UTSW 19 8,989,822 (GRCm39) intron probably benign
R5073:Ahnak UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
R5110:Ahnak UTSW 19 8,992,123 (GRCm39) missense probably damaging 1.00
R5119:Ahnak UTSW 19 8,991,008 (GRCm39) missense probably benign 0.00
R5128:Ahnak UTSW 19 8,994,451 (GRCm39) missense probably damaging 1.00
R5139:Ahnak UTSW 19 8,982,019 (GRCm39) missense probably damaging 1.00
R5150:Ahnak UTSW 19 8,988,268 (GRCm39) missense possibly damaging 0.46
R5151:Ahnak UTSW 19 8,994,933 (GRCm39) missense probably benign 0.03
R5165:Ahnak UTSW 19 8,993,029 (GRCm39) missense possibly damaging 0.95
R5236:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R5361:Ahnak UTSW 19 8,992,705 (GRCm39) missense possibly damaging 0.92
R5366:Ahnak UTSW 19 8,994,099 (GRCm39) missense possibly damaging 0.65
R5387:Ahnak UTSW 19 8,981,055 (GRCm39) missense probably damaging 1.00
R5396:Ahnak UTSW 19 8,984,539 (GRCm39) missense probably damaging 0.99
R5583:Ahnak UTSW 19 8,984,281 (GRCm39) missense probably damaging 0.99
R5587:Ahnak UTSW 19 8,986,840 (GRCm39) missense possibly damaging 0.88
R5620:Ahnak UTSW 19 8,990,458 (GRCm39) nonsense probably null
R5643:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5644:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5657:Ahnak UTSW 19 8,991,979 (GRCm39) missense probably damaging 0.99
R5688:Ahnak UTSW 19 8,979,883 (GRCm39) missense probably benign 0.01
R5702:Ahnak UTSW 19 8,979,204 (GRCm39) missense probably damaging 1.00
R5727:Ahnak UTSW 19 8,994,111 (GRCm39) missense probably damaging 0.99
R5730:Ahnak UTSW 19 8,987,617 (GRCm39) missense possibly damaging 0.81
R5755:Ahnak UTSW 19 8,979,096 (GRCm39) missense probably benign 0.06
R5760:Ahnak UTSW 19 8,990,926 (GRCm39) missense probably damaging 1.00
R5789:Ahnak UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
R5790:Ahnak UTSW 19 8,992,612 (GRCm39) missense probably damaging 0.99
R5795:Ahnak UTSW 19 8,989,746 (GRCm39) nonsense probably null
R5808:Ahnak UTSW 19 8,987,599 (GRCm39) missense possibly damaging 0.91
R5867:Ahnak UTSW 19 8,987,416 (GRCm39) missense probably damaging 0.99
R5878:Ahnak UTSW 19 8,985,706 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,995,575 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,991,131 (GRCm39) missense possibly damaging 0.63
R5912:Ahnak UTSW 19 8,989,267 (GRCm39) missense probably damaging 0.99
R5935:Ahnak UTSW 19 8,992,546 (GRCm39) missense possibly damaging 0.91
R5969:Ahnak UTSW 19 8,993,949 (GRCm39) missense probably damaging 1.00
R5988:Ahnak UTSW 19 8,986,711 (GRCm39) intron probably benign
R6000:Ahnak UTSW 19 8,990,475 (GRCm39) nonsense probably null
R6005:Ahnak UTSW 19 8,992,525 (GRCm39) missense possibly damaging 0.61
R6101:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6105:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6116:Ahnak UTSW 19 8,990,327 (GRCm39) intron probably benign
R6209:Ahnak UTSW 19 8,989,930 (GRCm39) missense probably damaging 1.00
R6240:Ahnak UTSW 19 8,990,947 (GRCm39) missense probably damaging 1.00
R6255:Ahnak UTSW 19 8,985,389 (GRCm39) missense possibly damaging 0.95
R6263:Ahnak UTSW 19 8,995,641 (GRCm39) missense probably benign 0.03
R6287:Ahnak UTSW 19 8,992,367 (GRCm39) missense probably benign 0.02
R6296:Ahnak UTSW 19 8,980,669 (GRCm39) missense probably damaging 0.99
R6315:Ahnak UTSW 19 8,983,990 (GRCm39) missense probably damaging 0.99
R6328:Ahnak UTSW 19 8,984,512 (GRCm39) missense probably benign 0.11
R6331:Ahnak UTSW 19 8,983,989 (GRCm39) missense probably benign 0.18
R6355:Ahnak UTSW 19 8,986,126 (GRCm39) missense probably benign 0.02
R6409:Ahnak UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
R6567:Ahnak UTSW 19 8,986,170 (GRCm39) missense probably benign 0.27
R6572:Ahnak UTSW 19 8,985,340 (GRCm39) missense probably damaging 0.99
R6574:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R6590:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6620:Ahnak UTSW 19 8,992,674 (GRCm39) missense possibly damaging 0.95
R6690:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6731:Ahnak UTSW 19 8,988,926 (GRCm39) missense possibly damaging 0.85
R6756:Ahnak UTSW 19 8,984,925 (GRCm39) missense possibly damaging 0.59
R6846:Ahnak UTSW 19 8,989,221 (GRCm39) missense possibly damaging 0.66
R6854:Ahnak UTSW 19 8,992,599 (GRCm39) missense probably damaging 1.00
R6857:Ahnak UTSW 19 9,014,532 (GRCm39) nonsense probably null
R6863:Ahnak UTSW 19 8,989,729 (GRCm39) intron probably benign
R6876:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R6958:Ahnak UTSW 19 8,992,579 (GRCm39) missense possibly damaging 0.88
R7126:Ahnak UTSW 19 8,979,723 (GRCm39) missense possibly damaging 0.61
R7181:Ahnak UTSW 19 8,990,852 (GRCm39) missense probably damaging 1.00
R7183:Ahnak UTSW 19 8,995,032 (GRCm39) missense probably damaging 1.00
R7202:Ahnak UTSW 19 8,995,163 (GRCm39) missense probably damaging 1.00
R7235:Ahnak UTSW 19 8,989,852 (GRCm39) missense unknown
R7241:Ahnak UTSW 19 8,986,395 (GRCm39) missense possibly damaging 0.65
R7269:Ahnak UTSW 19 8,983,981 (GRCm39) missense probably damaging 1.00
R7311:Ahnak UTSW 19 8,979,507 (GRCm39) missense probably benign 0.04
R7311:Ahnak UTSW 19 8,987,191 (GRCm39) missense possibly damaging 0.56
R7329:Ahnak UTSW 19 8,979,156 (GRCm39) missense probably damaging 0.99
R7339:Ahnak UTSW 19 8,985,529 (GRCm39) missense possibly damaging 0.75
R7390:Ahnak UTSW 19 8,980,569 (GRCm39) missense probably benign 0.02
R7400:Ahnak UTSW 19 8,991,977 (GRCm39) missense probably damaging 0.99
R7444:Ahnak UTSW 19 8,984,787 (GRCm39) missense probably benign 0.08
R7483:Ahnak UTSW 19 8,982,186 (GRCm39) missense probably damaging 1.00
R7498:Ahnak UTSW 19 8,989,383 (GRCm39) missense probably benign 0.14
R7521:Ahnak UTSW 19 8,979,715 (GRCm39) missense possibly damaging 0.89
R7522:Ahnak UTSW 19 8,979,686 (GRCm39) missense probably benign 0.01
R7552:Ahnak UTSW 19 8,984,188 (GRCm39) missense probably benign 0.18
R7563:Ahnak UTSW 19 8,988,529 (GRCm39) missense probably damaging 0.99
R7565:Ahnak UTSW 19 8,993,520 (GRCm39) missense probably benign 0.05
R7571:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R7583:Ahnak UTSW 19 8,983,457 (GRCm39) missense possibly damaging 0.90
R7600:Ahnak UTSW 19 8,981,938 (GRCm39) missense possibly damaging 0.89
R7771:Ahnak UTSW 19 8,992,411 (GRCm39) missense probably damaging 0.99
R7787:Ahnak UTSW 19 8,986,679 (GRCm39) missense unknown
R7827:Ahnak UTSW 19 8,982,708 (GRCm39) nonsense probably null
R7857:Ahnak UTSW 19 8,984,832 (GRCm39) missense probably damaging 0.97
R7916:Ahnak UTSW 19 8,983,196 (GRCm39) missense possibly damaging 0.66
R7939:Ahnak UTSW 19 8,991,448 (GRCm39) nonsense probably null
R7959:Ahnak UTSW 19 8,988,013 (GRCm39) missense possibly damaging 0.46
R7962:Ahnak UTSW 19 8,990,164 (GRCm39) missense unknown
R7979:Ahnak UTSW 19 8,988,796 (GRCm39) missense probably damaging 1.00
R8006:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R8013:Ahnak UTSW 19 8,986,699 (GRCm39) missense unknown
R8033:Ahnak UTSW 19 8,981,074 (GRCm39) missense probably benign 0.10
R8124:Ahnak UTSW 19 8,984,487 (GRCm39) missense probably damaging 0.99
R8125:Ahnak UTSW 19 8,989,240 (GRCm39) missense possibly damaging 0.95
R8129:Ahnak UTSW 19 8,977,464 (GRCm39) start codon destroyed not run
R8151:Ahnak UTSW 19 8,982,043 (GRCm39) missense possibly damaging 0.59
R8190:Ahnak UTSW 19 8,979,619 (GRCm39) missense probably benign 0.01
R8221:Ahnak UTSW 19 8,987,800 (GRCm39) nonsense probably null
R8241:Ahnak UTSW 19 8,984,659 (GRCm39) missense probably benign 0.15
R8244:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8248:Ahnak UTSW 19 8,979,310 (GRCm39) missense probably damaging 1.00
R8261:Ahnak UTSW 19 8,982,817 (GRCm39) missense probably damaging 1.00
R8330:Ahnak UTSW 19 8,987,026 (GRCm39) missense possibly damaging 0.86
R8380:Ahnak UTSW 19 8,995,219 (GRCm39) missense probably benign 0.05
R8407:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8409:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8463:Ahnak UTSW 19 8,986,113 (GRCm39) missense probably benign 0.07
R8511:Ahnak UTSW 19 8,989,719 (GRCm39) missense unknown
R8528:Ahnak UTSW 19 8,985,092 (GRCm39) missense probably damaging 1.00
R8549:Ahnak UTSW 19 8,988,847 (GRCm39) missense probably damaging 1.00
R8674:Ahnak UTSW 19 8,983,360 (GRCm39) missense probably damaging 0.98
R8716:Ahnak UTSW 19 8,986,438 (GRCm39) missense probably damaging 1.00
R8722:Ahnak UTSW 19 8,990,710 (GRCm39) nonsense probably null
R8751:Ahnak UTSW 19 8,987,509 (GRCm39) missense probably damaging 1.00
R8752:Ahnak UTSW 19 8,992,901 (GRCm39) missense probably damaging 1.00
R8783:Ahnak UTSW 19 8,988,837 (GRCm39) missense probably damaging 1.00
R8844:Ahnak UTSW 19 8,984,254 (GRCm39) missense probably damaging 1.00
R8859:Ahnak UTSW 19 8,984,567 (GRCm39) missense probably damaging 1.00
R8882:Ahnak UTSW 19 8,978,106 (GRCm39) missense probably damaging 1.00
R8907:Ahnak UTSW 19 8,986,452 (GRCm39) missense probably benign 0.24
R8938:Ahnak UTSW 19 8,989,099 (GRCm39) missense probably benign 0.00
R8975:Ahnak UTSW 19 8,990,101 (GRCm39) missense probably damaging 1.00
R8983:Ahnak UTSW 19 8,981,477 (GRCm39) missense possibly damaging 0.75
R9017:Ahnak UTSW 19 8,987,487 (GRCm39) missense probably damaging 1.00
R9027:Ahnak UTSW 19 8,984,617 (GRCm39) missense possibly damaging 0.94
R9081:Ahnak UTSW 19 8,985,890 (GRCm39) missense possibly damaging 0.81
R9104:Ahnak UTSW 19 8,987,711 (GRCm39) missense probably benign 0.01
R9112:Ahnak UTSW 19 8,987,149 (GRCm39) missense probably damaging 0.98
R9145:Ahnak UTSW 19 8,992,287 (GRCm39) missense probably benign 0.38
R9189:Ahnak UTSW 19 8,988,247 (GRCm39) missense possibly damaging 0.92
R9221:Ahnak UTSW 19 8,989,943 (GRCm39) missense probably damaging 1.00
R9261:Ahnak UTSW 19 8,993,503 (GRCm39) missense possibly damaging 0.63
R9299:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9325:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R9340:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R9351:Ahnak UTSW 19 8,985,232 (GRCm39) missense probably damaging 1.00
R9416:Ahnak UTSW 19 8,990,266 (GRCm39) missense unknown
R9462:Ahnak UTSW 19 8,981,299 (GRCm39) missense probably damaging 0.96
R9469:Ahnak UTSW 19 8,988,225 (GRCm39) missense probably damaging 1.00
R9485:Ahnak UTSW 19 8,979,438 (GRCm39) missense probably benign 0.16
R9503:Ahnak UTSW 19 8,987,458 (GRCm39) missense probably damaging 1.00
R9524:Ahnak UTSW 19 9,014,617 (GRCm39) missense
R9534:Ahnak UTSW 19 8,980,976 (GRCm39) missense probably benign 0.20
R9598:Ahnak UTSW 19 8,981,149 (GRCm39) missense probably benign 0.42
R9611:Ahnak UTSW 19 8,989,162 (GRCm39) missense probably damaging 0.99
R9624:Ahnak UTSW 19 8,989,846 (GRCm39) missense unknown
R9649:Ahnak UTSW 19 8,985,786 (GRCm39) nonsense probably null
R9683:Ahnak UTSW 19 8,984,719 (GRCm39) missense possibly damaging 0.94
R9691:Ahnak UTSW 19 8,989,090 (GRCm39) missense possibly damaging 0.49
R9712:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9712:Ahnak UTSW 19 8,984,392 (GRCm39) small deletion probably benign
R9713:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9715:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9725:Ahnak UTSW 19 8,991,607 (GRCm39) missense probably damaging 1.00
R9725:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R9747:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R9798:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
RF007:Ahnak UTSW 19 8,990,965 (GRCm39) missense possibly damaging 0.45
X0021:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
X0027:Ahnak UTSW 19 8,989,401 (GRCm39) missense probably damaging 1.00
Z1088:Ahnak UTSW 19 8,993,446 (GRCm39) missense probably damaging 0.99
Z1176:Ahnak UTSW 19 8,986,220 (GRCm39) missense probably damaging 0.97
Z1177:Ahnak UTSW 19 8,994,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCCCCAAGTTCAAGATG -3'
(R):5'- TCAGGCATCTTGAACTTGGGAC -3'

Sequencing Primer
(F):5'- CCCAAGTTCAAGATGCCTGAGATG -3'
(R):5'- TTGAACTTGGGACCCTTCAG -3'
Posted On 2022-04-18