Incidental Mutation 'R9338:Vmn2r77'
ID 707301
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Name vomeronasal 2, receptor 77
Synonyms EG546983
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86444349-86461240 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86460994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 773 (N773K)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
AlphaFold L7N2B7
Predicted Effect probably damaging
Transcript: ENSMUST00000164996
AA Change: N773K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: N773K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Adam30 G A 3: 98,070,129 (GRCm39) G654D probably damaging Het
Cct3 T C 3: 88,225,706 (GRCm39) V343A probably benign Het
Col11a2 A G 17: 34,266,204 (GRCm39) T358A unknown Het
Cox6a2 T C 7: 127,804,914 (GRCm39) Y94C probably damaging Het
Cubn T A 2: 13,386,703 (GRCm39) I1521F probably damaging Het
Dclk3 C A 9: 111,268,373 (GRCm39) A14E unknown Het
Dlgap2 T C 8: 14,229,683 (GRCm39) probably null Het
Dop1b C A 16: 93,600,448 (GRCm39) Q2042K probably damaging Het
Ech1 A G 7: 28,525,427 (GRCm39) S61G probably null Het
Ext2 T A 2: 93,526,603 (GRCm39) N678Y probably damaging Het
Fgfr2 G T 7: 129,863,561 (GRCm39) C28* probably null Het
Gon4l C A 3: 88,809,019 (GRCm39) D1754E probably benign Het
Hivep2 T A 10: 14,004,693 (GRCm39) C430* probably null Het
Htr7 C T 19: 35,941,780 (GRCm39) probably null Het
Idh3b A T 2: 130,122,392 (GRCm39) M331K probably damaging Het
Ighv2-7 A T 12: 113,771,118 (GRCm39) F56I probably benign Het
Inpp5k C T 11: 75,536,411 (GRCm39) H330Y probably damaging Het
Kif26b T C 1: 178,744,058 (GRCm39) Y1385H probably damaging Het
Mad1l1 A G 5: 140,074,561 (GRCm39) L543P probably damaging Het
Mdn1 A T 4: 32,666,536 (GRCm39) H158L probably benign Het
Mpp2 T A 11: 101,951,249 (GRCm39) T511S probably benign Het
Msantd5f6 T C 4: 73,320,245 (GRCm39) E178G possibly damaging Het
Msh4 T C 3: 153,573,444 (GRCm39) I737V possibly damaging Het
Myo15b T C 11: 115,762,238 (GRCm39) L1186P Het
Nckap1l A G 15: 103,379,991 (GRCm39) T346A probably benign Het
Nox4 G A 7: 87,025,448 (GRCm39) R525Q probably benign Het
Npy5r T C 8: 67,134,658 (GRCm39) N45S probably benign Het
Or6c202 T C 10: 128,996,610 (GRCm39) N81S probably benign Het
Pde6a G A 18: 61,354,109 (GRCm39) A145T probably damaging Het
Pfkp A C 13: 6,634,724 (GRCm39) S678A probably damaging Het
Phxr2 A G 10: 98,962,043 (GRCm39) probably benign Het
Pi4ka C A 16: 17,135,227 (GRCm39) L942F Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2g4e T A 2: 120,019,914 (GRCm39) T179S probably benign Het
Popdc2 G A 16: 38,194,509 (GRCm39) C310Y probably benign Het
Ppip5k1 C T 2: 121,153,827 (GRCm39) R113Q Het
Prmt7 C T 8: 106,961,665 (GRCm39) R193C unknown Het
Prph G C 15: 98,955,359 (GRCm39) R442P probably damaging Het
Prrc2b A G 2: 32,098,779 (GRCm39) Y697C probably damaging Het
Ptprm T A 17: 67,069,143 (GRCm39) R962S probably damaging Het
Raph1 A G 1: 60,529,300 (GRCm39) S654P unknown Het
Reln A G 5: 22,202,937 (GRCm39) F1288L probably damaging Het
Rhot1 T A 11: 80,145,568 (GRCm39) I553N probably benign Het
Rnf168 T C 16: 32,110,801 (GRCm39) probably null Het
Slamf6 T A 1: 171,747,157 (GRCm39) probably benign Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,689,458 (GRCm39) probably benign Het
Taf4b C T 18: 14,954,555 (GRCm39) P544S probably benign Het
Tbc1d24 A G 17: 24,427,377 (GRCm39) V195A probably benign Het
Tomm70a A G 16: 56,942,399 (GRCm39) M59V probably benign Het
Trip12 A G 1: 84,727,019 (GRCm39) S1184P probably damaging Het
Trrap A G 5: 144,727,925 (GRCm39) S549G probably benign Het
Unc5d T A 8: 29,709,471 (GRCm39) probably benign Het
Ush2a G A 1: 188,308,489 (GRCm39) probably null Het
Usp45 T C 4: 21,784,755 (GRCm39) V147A probably damaging Het
Vps13c A T 9: 67,858,977 (GRCm39) N2809I probably damaging Het
Yeats2 T A 16: 20,032,078 (GRCm39) S984R possibly damaging Het
Yeats2 T A 16: 20,041,533 (GRCm39) L1141Q probably damaging Het
Zfp58 T A 13: 67,639,394 (GRCm39) T366S probably benign Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86,449,975 (GRCm39) missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86,460,872 (GRCm39) missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86,461,124 (GRCm39) missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86,460,857 (GRCm39) missense probably benign
IGL01805:Vmn2r77 APN 7 86,460,395 (GRCm39) missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86,452,224 (GRCm39) missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86,450,678 (GRCm39) missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86,450,763 (GRCm39) missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86,452,836 (GRCm39) nonsense probably null
IGL02185:Vmn2r77 APN 7 86,444,360 (GRCm39) missense unknown
IGL02200:Vmn2r77 APN 7 86,451,187 (GRCm39) missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86,451,224 (GRCm39) missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86,452,848 (GRCm39) nonsense probably null
IGL02557:Vmn2r77 APN 7 86,444,342 (GRCm39) unclassified probably benign
IGL02659:Vmn2r77 APN 7 86,449,979 (GRCm39) missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86,460,555 (GRCm39) missense probably benign
IGL03180:Vmn2r77 APN 7 86,450,843 (GRCm39) missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86,461,131 (GRCm39) missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86,460,494 (GRCm39) missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86,451,146 (GRCm39) missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86,460,858 (GRCm39) missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86,450,702 (GRCm39) missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86,460,383 (GRCm39) missense probably benign
R0689:Vmn2r77 UTSW 7 86,460,872 (GRCm39) missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86,451,224 (GRCm39) missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86,450,954 (GRCm39) missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86,450,242 (GRCm39) critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86,451,394 (GRCm39) missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86,450,830 (GRCm39) missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86,450,830 (GRCm39) missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86,460,356 (GRCm39) missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86,461,123 (GRCm39) missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86,444,543 (GRCm39) missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86,450,821 (GRCm39) missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86,461,001 (GRCm39) missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86,450,921 (GRCm39) missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86,450,702 (GRCm39) missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86,461,152 (GRCm39) missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86,460,897 (GRCm39) missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86,452,893 (GRCm39) missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86,452,893 (GRCm39) missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86,450,191 (GRCm39) missense probably benign
R3694:Vmn2r77 UTSW 7 86,450,044 (GRCm39) missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86,450,044 (GRCm39) missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86,444,368 (GRCm39) nonsense probably null
R3870:Vmn2r77 UTSW 7 86,461,050 (GRCm39) missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86,450,195 (GRCm39) missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86,450,195 (GRCm39) missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86,451,015 (GRCm39) missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86,460,846 (GRCm39) missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86,451,341 (GRCm39) missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86,451,271 (GRCm39) missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86,461,214 (GRCm39) missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86,461,235 (GRCm39) missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86,460,670 (GRCm39) nonsense probably null
R5899:Vmn2r77 UTSW 7 86,460,924 (GRCm39) missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86,450,878 (GRCm39) missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86,460,957 (GRCm39) missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86,451,031 (GRCm39) missense probably benign
R6419:Vmn2r77 UTSW 7 86,460,767 (GRCm39) missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86,450,065 (GRCm39) missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86,451,286 (GRCm39) missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86,452,202 (GRCm39) missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86,451,023 (GRCm39) missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86,451,035 (GRCm39) missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86,460,518 (GRCm39) nonsense probably null
R7298:Vmn2r77 UTSW 7 86,449,979 (GRCm39) missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86,460,492 (GRCm39) nonsense probably null
R8182:Vmn2r77 UTSW 7 86,460,801 (GRCm39) missense probably damaging 1.00
R8327:Vmn2r77 UTSW 7 86,450,680 (GRCm39) missense probably benign 0.08
R8387:Vmn2r77 UTSW 7 86,450,947 (GRCm39) missense probably benign 0.00
R8825:Vmn2r77 UTSW 7 86,452,855 (GRCm39) missense probably benign
R8898:Vmn2r77 UTSW 7 86,444,430 (GRCm39) missense probably damaging 1.00
R8973:Vmn2r77 UTSW 7 86,452,150 (GRCm39) missense possibly damaging 0.93
R9258:Vmn2r77 UTSW 7 86,452,302 (GRCm39) missense possibly damaging 0.88
R9358:Vmn2r77 UTSW 7 86,452,236 (GRCm39) missense probably benign 0.00
R9377:Vmn2r77 UTSW 7 86,444,442 (GRCm39) missense probably benign 0.05
R9404:Vmn2r77 UTSW 7 86,451,247 (GRCm39) missense probably benign
R9673:Vmn2r77 UTSW 7 86,450,171 (GRCm39) missense possibly damaging 0.75
R9679:Vmn2r77 UTSW 7 86,460,741 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCCATATGCACCATGATCCAAATG -3'
(R):5'- ACAGAATAATGTAGCACTTTGGGAG -3'

Sequencing Primer
(F):5'- CCAAATGATTCTCTGTGGAATCTGGC -3'
(R):5'- AGCACTTTGGGAGAAATATACAAAC -3'
Posted On 2022-04-18