Incidental Mutation 'R9338:Dlgap2'
ID 707305
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene Name DLG associated protein 2
Synonyms PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 14095865-14847680 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 14179683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
AlphaFold Q8BJ42
Predicted Effect probably benign
Transcript: ENSMUST00000043279
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133298
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150247
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 (GRCm38) T22A possibly damaging Het
Adam30 G A 3: 98,162,813 (GRCm38) G654D probably damaging Het
Cct3 T C 3: 88,318,399 (GRCm38) V343A probably benign Het
Col11a2 A G 17: 34,047,230 (GRCm38) T358A unknown Het
Cox6a2 T C 7: 128,205,742 (GRCm38) Y94C probably damaging Het
Cubn T A 2: 13,381,892 (GRCm38) I1521F probably damaging Het
Dclk3 C A 9: 111,439,305 (GRCm38) A14E unknown Het
Dopey2 C A 16: 93,803,560 (GRCm38) Q2042K probably damaging Het
Ech1 A G 7: 28,826,002 (GRCm38) S61G probably null Het
Ext2 T A 2: 93,696,258 (GRCm38) N678Y probably damaging Het
Fgfr2 G T 7: 130,261,831 (GRCm38) C28* probably null Het
Gm11487 T C 4: 73,402,008 (GRCm38) E178G possibly damaging Het
Gon4l C A 3: 88,901,712 (GRCm38) D1754E probably benign Het
Hivep2 T A 10: 14,128,949 (GRCm38) C430* probably null Het
Htr7 C T 19: 35,964,380 (GRCm38) probably null Het
Idh3b A T 2: 130,280,472 (GRCm38) M331K probably damaging Het
Ighv2-7 A T 12: 113,807,498 (GRCm38) F56I probably benign Het
Inpp5k C T 11: 75,645,585 (GRCm38) H330Y probably damaging Het
Kif26b T C 1: 178,916,493 (GRCm38) Y1385H probably damaging Het
Mad1l1 A G 5: 140,088,806 (GRCm38) L543P probably damaging Het
Mdn1 A T 4: 32,666,536 (GRCm38) H158L probably benign Het
Mpp2 T A 11: 102,060,423 (GRCm38) T511S probably benign Het
Msh4 T C 3: 153,867,807 (GRCm38) I737V possibly damaging Het
Myo15b T C 11: 115,871,412 (GRCm38) L1186P Het
Nckap1l A G 15: 103,471,564 (GRCm38) T346A probably benign Het
Nox4 G A 7: 87,376,240 (GRCm38) R525Q probably benign Het
Npy5r T C 8: 66,682,006 (GRCm38) N45S probably benign Het
Olfr771 T C 10: 129,160,741 (GRCm38) N81S probably benign Het
Pde6a G A 18: 61,221,037 (GRCm38) A145T probably damaging Het
Pfkp A C 13: 6,584,688 (GRCm38) S678A probably damaging Het
Phxr2 A G 10: 99,126,181 (GRCm38) probably benign Het
Pi4ka C A 16: 17,317,363 (GRCm38) L942F Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 (GRCm38) probably benign Het
Pla2g4e T A 2: 120,189,433 (GRCm38) T179S probably benign Het
Popdc2 G A 16: 38,374,147 (GRCm38) C310Y probably benign Het
Ppip5k1 C T 2: 121,323,346 (GRCm38) R113Q Het
Prmt7 C T 8: 106,235,033 (GRCm38) R193C unknown Het
Prph G C 15: 99,057,478 (GRCm38) R442P probably damaging Het
Prrc2b A G 2: 32,208,767 (GRCm38) Y697C probably damaging Het
Ptprm T A 17: 66,762,148 (GRCm38) R962S probably damaging Het
Raph1 A G 1: 60,490,141 (GRCm38) S654P unknown Het
Reln A G 5: 21,997,939 (GRCm38) F1288L probably damaging Het
Rhot1 T A 11: 80,254,742 (GRCm38) I553N probably benign Het
Rnf168 T C 16: 32,291,983 (GRCm38) probably null Het
Slamf6 T A 1: 171,919,590 (GRCm38) probably benign Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 (GRCm38) probably benign Het
Taf4b C T 18: 14,821,498 (GRCm38) P544S probably benign Het
Tbc1d24 A G 17: 24,208,403 (GRCm38) V195A probably benign Het
Tomm70a A G 16: 57,122,036 (GRCm38) M59V probably benign Het
Trip12 A G 1: 84,749,298 (GRCm38) S1184P probably damaging Het
Trrap A G 5: 144,791,115 (GRCm38) S549G probably benign Het
Unc5d T A 8: 29,219,443 (GRCm38) probably benign Het
Ush2a G A 1: 188,576,292 (GRCm38) probably null Het
Usp45 T C 4: 21,784,755 (GRCm38) V147A probably damaging Het
Vmn2r77 T A 7: 86,811,786 (GRCm38) N773K probably damaging Het
Vps13c A T 9: 67,951,695 (GRCm38) N2809I probably damaging Het
Yeats2 T A 16: 20,222,783 (GRCm38) L1141Q probably damaging Het
Yeats2 T A 16: 20,213,328 (GRCm38) S984R possibly damaging Het
Zfp58 T A 13: 67,491,275 (GRCm38) T366S probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14,778,301 (GRCm38) nonsense probably null
IGL01788:Dlgap2 APN 8 14,843,631 (GRCm38) missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14,843,552 (GRCm38) missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14,831,579 (GRCm38) missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14,727,525 (GRCm38) missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14,727,812 (GRCm38) missense probably damaging 0.99
G1Funyon:Dlgap2 UTSW 8 14,823,577 (GRCm38) missense probably benign 0.27
PIT4403001:Dlgap2 UTSW 8 14,831,528 (GRCm38) missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14,727,363 (GRCm38) nonsense probably null
R0242:Dlgap2 UTSW 8 14,727,562 (GRCm38) missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14,727,562 (GRCm38) missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14,727,591 (GRCm38) missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14,726,952 (GRCm38) missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14,831,228 (GRCm38) splice site probably benign
R1440:Dlgap2 UTSW 8 14,727,060 (GRCm38) missense probably benign
R1544:Dlgap2 UTSW 8 14,829,861 (GRCm38) splice site probably null
R1550:Dlgap2 UTSW 8 14,822,499 (GRCm38) missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14,727,809 (GRCm38) missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14,773,347 (GRCm38) missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14,843,624 (GRCm38) missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14,778,206 (GRCm38) missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14,743,431 (GRCm38) missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14,846,502 (GRCm38) missense probably benign
R4422:Dlgap2 UTSW 8 14,743,463 (GRCm38) critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14,727,871 (GRCm38) missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14,846,679 (GRCm38) missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14,727,999 (GRCm38) critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14,773,380 (GRCm38) missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14,822,691 (GRCm38) missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14,823,614 (GRCm38) missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14,823,614 (GRCm38) missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14,831,342 (GRCm38) nonsense probably null
R5964:Dlgap2 UTSW 8 14,727,128 (GRCm38) nonsense probably null
R6125:Dlgap2 UTSW 8 14,727,193 (GRCm38) missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14,727,294 (GRCm38) missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14,846,641 (GRCm38) missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14,822,369 (GRCm38) missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14,831,465 (GRCm38) missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14,743,284 (GRCm38) missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14,179,619 (GRCm38) intron probably benign
R6913:Dlgap2 UTSW 8 14,778,374 (GRCm38) missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14,743,296 (GRCm38) missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14,829,952 (GRCm38) missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14,822,697 (GRCm38) critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14,743,410 (GRCm38) missense probably benign 0.38
R7976:Dlgap2 UTSW 8 14,743,410 (GRCm38) missense probably benign 0.38
R8101:Dlgap2 UTSW 8 14,831,600 (GRCm38) missense probably benign 0.04
R8301:Dlgap2 UTSW 8 14,823,577 (GRCm38) missense probably benign 0.27
R8333:Dlgap2 UTSW 8 14,778,295 (GRCm38) missense probably benign 0.03
R8367:Dlgap2 UTSW 8 14,843,544 (GRCm38) missense probably benign 0.00
R8492:Dlgap2 UTSW 8 14,778,271 (GRCm38) missense possibly damaging 0.49
R8685:Dlgap2 UTSW 8 14,831,628 (GRCm38) missense possibly damaging 0.71
R8690:Dlgap2 UTSW 8 14,743,430 (GRCm38) missense probably benign 0.00
R8887:Dlgap2 UTSW 8 14,179,682 (GRCm38) critical splice donor site probably null
R9328:Dlgap2 UTSW 8 14,727,441 (GRCm38) missense probably damaging 1.00
R9465:Dlgap2 UTSW 8 14,778,226 (GRCm38) missense probably damaging 1.00
R9680:Dlgap2 UTSW 8 14,846,653 (GRCm38) missense probably damaging 0.98
X0060:Dlgap2 UTSW 8 14,839,787 (GRCm38) missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14,822,472 (GRCm38) missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14,727,659 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAGTCCCTATTGCTG -3'
(R):5'- TGACCACCTTGGCTCATCAG -3'

Sequencing Primer
(F):5'- TCAGTCTCCCGATTGCTGGG -3'
(R):5'- AGCTCCTCTCCAGTTGCCTAG -3'
Posted On 2022-04-18