Incidental Mutation 'R9338:Dlgap2'
ID 707305
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene Name DLG associated protein 2
Synonyms PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 14095865-14847680 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 14179683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
AlphaFold Q8BJ42
Predicted Effect probably benign
Transcript: ENSMUST00000043279
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133298
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150247
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam30 G A 3: 98,162,813 G654D probably damaging Het
Cct3 T C 3: 88,318,399 V343A probably benign Het
Col11a2 A G 17: 34,047,230 T358A unknown Het
Cox6a2 T C 7: 128,205,742 Y94C probably damaging Het
Cubn T A 2: 13,381,892 I1521F probably damaging Het
Dclk3 C A 9: 111,439,305 A14E unknown Het
Dopey2 C A 16: 93,803,560 Q2042K probably damaging Het
Ech1 A G 7: 28,826,002 S61G probably null Het
Ext2 T A 2: 93,696,258 N678Y probably damaging Het
Fgfr2 G T 7: 130,261,831 C28* probably null Het
Gm11487 T C 4: 73,402,008 E178G possibly damaging Het
Gon4l C A 3: 88,901,712 D1754E probably benign Het
Hivep2 T A 10: 14,128,949 C430* probably null Het
Htr7 C T 19: 35,964,380 probably null Het
Idh3b A T 2: 130,280,472 M331K probably damaging Het
Ighv2-7 A T 12: 113,807,498 F56I probably benign Het
Inpp5k C T 11: 75,645,585 H330Y probably damaging Het
Kif26b T C 1: 178,916,493 Y1385H probably damaging Het
Mad1l1 A G 5: 140,088,806 L543P probably damaging Het
Mdn1 A T 4: 32,666,536 H158L probably benign Het
Mpp2 T A 11: 102,060,423 T511S probably benign Het
Msh4 T C 3: 153,867,807 I737V possibly damaging Het
Myo15b T C 11: 115,871,412 L1186P Het
Nckap1l A G 15: 103,471,564 T346A probably benign Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Npy5r T C 8: 66,682,006 N45S probably benign Het
Olfr771 T C 10: 129,160,741 N81S probably benign Het
Pde6a G A 18: 61,221,037 A145T probably damaging Het
Pfkp A C 13: 6,584,688 S678A probably damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pi4ka C A 16: 17,317,363 L942F Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g4e T A 2: 120,189,433 T179S probably benign Het
Popdc2 G A 16: 38,374,147 C310Y probably benign Het
Ppip5k1 C T 2: 121,323,346 R113Q Het
Prmt7 C T 8: 106,235,033 R193C unknown Het
Prph G C 15: 99,057,478 R442P probably damaging Het
Prrc2b A G 2: 32,208,767 Y697C probably damaging Het
Ptprm T A 17: 66,762,148 R962S probably damaging Het
Raph1 A G 1: 60,490,141 S654P unknown Het
Reln A G 5: 21,997,939 F1288L probably damaging Het
Rhot1 T A 11: 80,254,742 I553N probably benign Het
Rnf168 T C 16: 32,291,983 probably null Het
Slamf6 T A 1: 171,919,590 probably benign Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Taf4b C T 18: 14,821,498 P544S probably benign Het
Tbc1d24 A G 17: 24,208,403 V195A probably benign Het
Tomm70a A G 16: 57,122,036 M59V probably benign Het
Trip12 A G 1: 84,749,298 S1184P probably damaging Het
Trrap A G 5: 144,791,115 S549G probably benign Het
Unc5d T A 8: 29,219,443 probably benign Het
Ush2a G A 1: 188,576,292 probably null Het
Usp45 T C 4: 21,784,755 V147A probably damaging Het
Vmn2r77 T A 7: 86,811,786 N773K probably damaging Het
Vps13c A T 9: 67,951,695 N2809I probably damaging Het
Yeats2 T A 16: 20,213,328 S984R possibly damaging Het
Yeats2 T A 16: 20,222,783 L1141Q probably damaging Het
Zfp58 T A 13: 67,491,275 T366S probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
G1Funyon:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R7976:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R8101:Dlgap2 UTSW 8 14831600 missense probably benign 0.04
R8301:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
R8333:Dlgap2 UTSW 8 14778295 missense probably benign 0.03
R8367:Dlgap2 UTSW 8 14843544 missense probably benign 0.00
R8492:Dlgap2 UTSW 8 14778271 missense possibly damaging 0.49
R8685:Dlgap2 UTSW 8 14831628 missense possibly damaging 0.71
R8690:Dlgap2 UTSW 8 14743430 missense probably benign 0.00
R8887:Dlgap2 UTSW 8 14179682 critical splice donor site probably null
R9328:Dlgap2 UTSW 8 14727441 missense probably damaging 1.00
R9465:Dlgap2 UTSW 8 14778226 missense probably damaging 1.00
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAGTCCCTATTGCTG -3'
(R):5'- TGACCACCTTGGCTCATCAG -3'

Sequencing Primer
(F):5'- TCAGTCTCCCGATTGCTGGG -3'
(R):5'- AGCTCCTCTCCAGTTGCCTAG -3'
Posted On 2022-04-18