Incidental Mutation 'R9338:Vps13c'
ID 707310
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Name vacuolar protein sorting 13C
Synonyms C230055H22Rik
Accession Numbers

Genbank: NM_177184; MGI: 2444207
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 67840396-67995638 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67951695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 2809 (N2809I)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: N2809I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: N2809I

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213168
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam30 G A 3: 98,162,813 G654D probably damaging Het
Cct3 T C 3: 88,318,399 V343A probably benign Het
Col11a2 A G 17: 34,047,230 T358A unknown Het
Cox6a2 T C 7: 128,205,742 Y94C probably damaging Het
Cubn T A 2: 13,381,892 I1521F probably damaging Het
Dclk3 C A 9: 111,439,305 A14E unknown Het
Dlgap2 T C 8: 14,179,683 probably null Het
Dopey2 C A 16: 93,803,560 Q2042K probably damaging Het
Ech1 A G 7: 28,826,002 S61G probably null Het
Ext2 T A 2: 93,696,258 N678Y probably damaging Het
Fgfr2 G T 7: 130,261,831 C28* probably null Het
Gm11487 T C 4: 73,402,008 E178G possibly damaging Het
Gon4l C A 3: 88,901,712 D1754E probably benign Het
Hivep2 T A 10: 14,128,949 C430* probably null Het
Htr7 C T 19: 35,964,380 probably null Het
Idh3b A T 2: 130,280,472 M331K probably damaging Het
Ighv2-7 A T 12: 113,807,498 F56I probably benign Het
Inpp5k C T 11: 75,645,585 H330Y probably damaging Het
Kif26b T C 1: 178,916,493 Y1385H probably damaging Het
Mad1l1 A G 5: 140,088,806 L543P probably damaging Het
Mdn1 A T 4: 32,666,536 H158L probably benign Het
Mpp2 T A 11: 102,060,423 T511S probably benign Het
Msh4 T C 3: 153,867,807 I737V possibly damaging Het
Myo15b T C 11: 115,871,412 L1186P Het
Nckap1l A G 15: 103,471,564 T346A probably benign Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Npy5r T C 8: 66,682,006 N45S probably benign Het
Olfr771 T C 10: 129,160,741 N81S probably benign Het
Pde6a G A 18: 61,221,037 A145T probably damaging Het
Pfkp A C 13: 6,584,688 S678A probably damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pi4ka C A 16: 17,317,363 L942F Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g4e T A 2: 120,189,433 T179S probably benign Het
Popdc2 G A 16: 38,374,147 C310Y probably benign Het
Ppip5k1 C T 2: 121,323,346 R113Q Het
Prmt7 C T 8: 106,235,033 R193C unknown Het
Prph G C 15: 99,057,478 R442P probably damaging Het
Prrc2b A G 2: 32,208,767 Y697C probably damaging Het
Ptprm T A 17: 66,762,148 R962S probably damaging Het
Raph1 A G 1: 60,490,141 S654P unknown Het
Reln A G 5: 21,997,939 F1288L probably damaging Het
Rhot1 T A 11: 80,254,742 I553N probably benign Het
Rnf168 T C 16: 32,291,983 probably null Het
Slamf6 T A 1: 171,919,590 probably benign Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Taf4b C T 18: 14,821,498 P544S probably benign Het
Tbc1d24 A G 17: 24,208,403 V195A probably benign Het
Tomm70a A G 16: 57,122,036 M59V probably benign Het
Trip12 A G 1: 84,749,298 S1184P probably damaging Het
Trrap A G 5: 144,791,115 S549G probably benign Het
Unc5d T A 8: 29,219,443 probably benign Het
Ush2a G A 1: 188,576,292 probably null Het
Usp45 T C 4: 21,784,755 V147A probably damaging Het
Vmn2r77 T A 7: 86,811,786 N773K probably damaging Het
Yeats2 T A 16: 20,213,328 S984R possibly damaging Het
Yeats2 T A 16: 20,222,783 L1141Q probably damaging Het
Zfp58 T A 13: 67,491,275 T366S probably benign Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
Derivative UTSW 9 67930622 missense possibly damaging 0.79
diversion UTSW 9 67910233 missense possibly damaging 0.93
introversion UTSW 9 67944046 missense probably damaging 0.98
Inversion UTSW 9 67902839 critical splice acceptor site probably null
subversion UTSW 9 67908052 missense probably damaging 1.00
Transversion UTSW 9 67934501 missense probably damaging 0.98
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 splice site probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 splice site probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
R7748:Vps13c UTSW 9 67963089 missense probably benign 0.03
R7779:Vps13c UTSW 9 67881422 missense probably damaging 1.00
R7788:Vps13c UTSW 9 67940483 missense probably benign 0.01
R7894:Vps13c UTSW 9 67926983 missense probably damaging 0.99
R8163:Vps13c UTSW 9 67950438 missense probably benign 0.08
R8165:Vps13c UTSW 9 67858790 missense probably benign 0.00
R8202:Vps13c UTSW 9 67944046 missense probably damaging 0.98
R8235:Vps13c UTSW 9 67927396 missense probably damaging 1.00
R8235:Vps13c UTSW 9 67955781 missense probably benign 0.01
R8253:Vps13c UTSW 9 67943488 nonsense probably null
R8261:Vps13c UTSW 9 67954980 missense probably damaging 1.00
R8348:Vps13c UTSW 9 67879103 missense possibly damaging 0.79
R8547:Vps13c UTSW 9 67945566 missense probably damaging 1.00
R8734:Vps13c UTSW 9 67973403 missense probably damaging 1.00
R8806:Vps13c UTSW 9 67945828 missense probably damaging 1.00
R8807:Vps13c UTSW 9 67858840 missense probably damaging 0.99
R8813:Vps13c UTSW 9 67871284 missense probably damaging 1.00
R8883:Vps13c UTSW 9 67948197 missense probably benign 0.10
R8885:Vps13c UTSW 9 67943454 missense probably benign
R8899:Vps13c UTSW 9 67934501 missense probably damaging 0.98
R8970:Vps13c UTSW 9 67945521 missense probably benign 0.11
R9007:Vps13c UTSW 9 67937724 missense probably benign 0.00
R9026:Vps13c UTSW 9 67954581 missense probably damaging 1.00
R9029:Vps13c UTSW 9 67948147 missense probably damaging 0.98
R9057:Vps13c UTSW 9 67920927 missense probably benign 0.00
R9105:Vps13c UTSW 9 67870799 intron probably benign
R9130:Vps13c UTSW 9 67929523 missense probably damaging 1.00
R9286:Vps13c UTSW 9 67972921 missense probably benign 0.00
R9432:Vps13c UTSW 9 67922855 missense probably benign 0.02
R9460:Vps13c UTSW 9 67930622 missense possibly damaging 0.79
R9464:Vps13c UTSW 9 67951392 missense probably damaging 1.00
R9561:Vps13c UTSW 9 67965512 missense probably damaging 1.00
R9609:Vps13c UTSW 9 67934549 missense probably damaging 1.00
R9622:Vps13c UTSW 9 67949433 missense probably damaging 1.00
R9665:Vps13c UTSW 9 67955743 nonsense probably null
R9731:Vps13c UTSW 9 67919244 missense probably benign
R9763:Vps13c UTSW 9 67911578 missense probably benign 0.00
R9774:Vps13c UTSW 9 67884591 missense possibly damaging 0.85
R9798:Vps13c UTSW 9 67919364 missense probably damaging 1.00
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCAGACACTGCAGAAG -3'
(R):5'- AGCCCTGCTTCAGCTGATTG -3'

Sequencing Primer
(F):5'- AGTTGACCTGTCAGTTCACGTCAG -3'
(R):5'- GCTGCTGTGAGTTCCTAATGTCC -3'
Posted On 2022-04-18