Incidental Mutation 'R9338:Myo15b'
ID 707319
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Name myosin XVB
Synonyms LOC217328, E330039G21Rik, LOC380737
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115858406-115892603 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115871412 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1186 (L1186P)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: L1186P

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam30 G A 3: 98,162,813 G654D probably damaging Het
Cct3 T C 3: 88,318,399 V343A probably benign Het
Col11a2 A G 17: 34,047,230 T358A unknown Het
Cox6a2 T C 7: 128,205,742 Y94C probably damaging Het
Cubn T A 2: 13,381,892 I1521F probably damaging Het
Dclk3 C A 9: 111,439,305 A14E unknown Het
Dlgap2 T C 8: 14,179,683 probably null Het
Dopey2 C A 16: 93,803,560 Q2042K probably damaging Het
Ech1 A G 7: 28,826,002 S61G probably null Het
Ext2 T A 2: 93,696,258 N678Y probably damaging Het
Fgfr2 G T 7: 130,261,831 C28* probably null Het
Gm11487 T C 4: 73,402,008 E178G possibly damaging Het
Gon4l C A 3: 88,901,712 D1754E probably benign Het
Hivep2 T A 10: 14,128,949 C430* probably null Het
Htr7 C T 19: 35,964,380 probably null Het
Idh3b A T 2: 130,280,472 M331K probably damaging Het
Ighv2-7 A T 12: 113,807,498 F56I probably benign Het
Inpp5k C T 11: 75,645,585 H330Y probably damaging Het
Kif26b T C 1: 178,916,493 Y1385H probably damaging Het
Mad1l1 A G 5: 140,088,806 L543P probably damaging Het
Mdn1 A T 4: 32,666,536 H158L probably benign Het
Mpp2 T A 11: 102,060,423 T511S probably benign Het
Msh4 T C 3: 153,867,807 I737V possibly damaging Het
Nckap1l A G 15: 103,471,564 T346A probably benign Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Npy5r T C 8: 66,682,006 N45S probably benign Het
Olfr771 T C 10: 129,160,741 N81S probably benign Het
Pde6a G A 18: 61,221,037 A145T probably damaging Het
Pfkp A C 13: 6,584,688 S678A probably damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pi4ka C A 16: 17,317,363 L942F Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g4e T A 2: 120,189,433 T179S probably benign Het
Popdc2 G A 16: 38,374,147 C310Y probably benign Het
Ppip5k1 C T 2: 121,323,346 R113Q Het
Prmt7 C T 8: 106,235,033 R193C unknown Het
Prph G C 15: 99,057,478 R442P probably damaging Het
Prrc2b A G 2: 32,208,767 Y697C probably damaging Het
Ptprm T A 17: 66,762,148 R962S probably damaging Het
Raph1 A G 1: 60,490,141 S654P unknown Het
Reln A G 5: 21,997,939 F1288L probably damaging Het
Rhot1 T A 11: 80,254,742 I553N probably benign Het
Rnf168 T C 16: 32,291,983 probably null Het
Slamf6 T A 1: 171,919,590 probably benign Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Taf4b C T 18: 14,821,498 P544S probably benign Het
Tbc1d24 A G 17: 24,208,403 V195A probably benign Het
Tomm70a A G 16: 57,122,036 M59V probably benign Het
Trip12 A G 1: 84,749,298 S1184P probably damaging Het
Trrap A G 5: 144,791,115 S549G probably benign Het
Unc5d T A 8: 29,219,443 probably benign Het
Ush2a G A 1: 188,576,292 probably null Het
Usp45 T C 4: 21,784,755 V147A probably damaging Het
Vmn2r77 T A 7: 86,811,786 N773K probably damaging Het
Vps13c A T 9: 67,951,695 N2809I probably damaging Het
Yeats2 T A 16: 20,213,328 S984R possibly damaging Het
Yeats2 T A 16: 20,222,783 L1141Q probably damaging Het
Zfp58 T A 13: 67,491,275 T366S probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
R6963:Myo15b UTSW 11 115890714 splice site probably null
R7015:Myo15b UTSW 11 115871844 missense
R7020:Myo15b UTSW 11 115866667 nonsense probably null
R7096:Myo15b UTSW 11 115891498 splice site probably null
R7219:Myo15b UTSW 11 115877095 critical splice donor site probably null
R7400:Myo15b UTSW 11 115860113 missense
R7413:Myo15b UTSW 11 115878144 missense
R7483:Myo15b UTSW 11 115858744 missense
R7523:Myo15b UTSW 11 115890858 missense unknown
R7737:Myo15b UTSW 11 115887923 missense unknown
R7784:Myo15b UTSW 11 115861340 missense
R7842:Myo15b UTSW 11 115871495 missense
R7921:Myo15b UTSW 11 115887178 nonsense probably null
R8065:Myo15b UTSW 11 115887943 critical splice donor site probably null
R8183:Myo15b UTSW 11 115883017 splice site probably null
R8193:Myo15b UTSW 11 115885147 missense probably damaging 1.00
R8237:Myo15b UTSW 11 115877001 missense
R8430:Myo15b UTSW 11 115882223 missense probably benign 0.02
R8482:Myo15b UTSW 11 115883257 nonsense probably null
R8515:Myo15b UTSW 11 115858784 missense
R8798:Myo15b UTSW 11 115863406 missense
R8937:Myo15b UTSW 11 115882301 missense probably benign 0.00
R8975:Myo15b UTSW 11 115890954 missense unknown
R9045:Myo15b UTSW 11 115892352 makesense probably null
R9117:Myo15b UTSW 11 115887917 missense possibly damaging 0.91
R9185:Myo15b UTSW 11 115880429 missense unknown
R9226:Myo15b UTSW 11 115860098 missense
R9302:Myo15b UTSW 11 115885412 missense possibly damaging 0.83
R9318:Myo15b UTSW 11 115885139 missense probably benign 0.26
R9336:Myo15b UTSW 11 115880238 missense
R9337:Myo15b UTSW 11 115859035 missense
R9498:Myo15b UTSW 11 115879958 missense
R9500:Myo15b UTSW 11 115886640 missense probably damaging 0.98
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Z1176:Myo15b UTSW 11 115883452 missense possibly damaging 0.81
Z1176:Myo15b UTSW 11 115887925 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCAGGTGCACAGAGAGCTTTG -3'
(R):5'- TGGATGACGTAGACATGGCC -3'

Sequencing Primer
(F):5'- CACAGAGAGCTTTGCGGGG -3'
(R):5'- GGACAGTAGTCATAGATCCCACTTC -3'
Posted On 2022-04-18