Incidental Mutation 'R9338:Prph'
ID 707323
Institutional Source Beutler Lab
Gene Symbol Prph
Ensembl Gene ENSMUSG00000023484
Gene Name peripherin
Synonyms Prph1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9338 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99055174-99058978 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 99057478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 442 (R442P)
Ref Sequence ENSEMBL: ENSMUSP00000049303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024249] [ENSMUST00000047104] [ENSMUST00000229268] [ENSMUST00000230021]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000024249
AA Change: R410P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024249
Gene: ENSMUSG00000023484
AA Change: R410P

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 2.7e-18 PFAM
Pfam:Filament 100 410 4.5e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047104
AA Change: R442P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049303
Gene: ENSMUSG00000023484
AA Change: R442P

DomainStartEndE-ValueType
Pfam:Filament_head 19 99 3.2e-18 PFAM
Filament 100 442 1.87e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229268
Predicted Effect probably damaging
Transcript: ENSMUST00000230021
AA Change: R442P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice showed no overt phenotype up to 14 months of age. While overall structure, number, and caliber of large myelinated axons was normal, mice had reduced numbers of a small subset of unmelinated sensory axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam30 G A 3: 98,162,813 G654D probably damaging Het
Cct3 T C 3: 88,318,399 V343A probably benign Het
Col11a2 A G 17: 34,047,230 T358A unknown Het
Cox6a2 T C 7: 128,205,742 Y94C probably damaging Het
Cubn T A 2: 13,381,892 I1521F probably damaging Het
Dclk3 C A 9: 111,439,305 A14E unknown Het
Dlgap2 T C 8: 14,179,683 probably null Het
Dopey2 C A 16: 93,803,560 Q2042K probably damaging Het
Ech1 A G 7: 28,826,002 S61G probably null Het
Ext2 T A 2: 93,696,258 N678Y probably damaging Het
Fgfr2 G T 7: 130,261,831 C28* probably null Het
Gm11487 T C 4: 73,402,008 E178G possibly damaging Het
Gon4l C A 3: 88,901,712 D1754E probably benign Het
Hivep2 T A 10: 14,128,949 C430* probably null Het
Htr7 C T 19: 35,964,380 probably null Het
Idh3b A T 2: 130,280,472 M331K probably damaging Het
Ighv2-7 A T 12: 113,807,498 F56I probably benign Het
Inpp5k C T 11: 75,645,585 H330Y probably damaging Het
Kif26b T C 1: 178,916,493 Y1385H probably damaging Het
Mad1l1 A G 5: 140,088,806 L543P probably damaging Het
Mdn1 A T 4: 32,666,536 H158L probably benign Het
Mpp2 T A 11: 102,060,423 T511S probably benign Het
Msh4 T C 3: 153,867,807 I737V possibly damaging Het
Myo15b T C 11: 115,871,412 L1186P Het
Nckap1l A G 15: 103,471,564 T346A probably benign Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Npy5r T C 8: 66,682,006 N45S probably benign Het
Olfr771 T C 10: 129,160,741 N81S probably benign Het
Pde6a G A 18: 61,221,037 A145T probably damaging Het
Pfkp A C 13: 6,584,688 S678A probably damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pi4ka C A 16: 17,317,363 L942F Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g4e T A 2: 120,189,433 T179S probably benign Het
Popdc2 G A 16: 38,374,147 C310Y probably benign Het
Ppip5k1 C T 2: 121,323,346 R113Q Het
Prmt7 C T 8: 106,235,033 R193C unknown Het
Prrc2b A G 2: 32,208,767 Y697C probably damaging Het
Ptprm T A 17: 66,762,148 R962S probably damaging Het
Raph1 A G 1: 60,490,141 S654P unknown Het
Reln A G 5: 21,997,939 F1288L probably damaging Het
Rhot1 T A 11: 80,254,742 I553N probably benign Het
Rnf168 T C 16: 32,291,983 probably null Het
Slamf6 T A 1: 171,919,590 probably benign Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Taf4b C T 18: 14,821,498 P544S probably benign Het
Tbc1d24 A G 17: 24,208,403 V195A probably benign Het
Tomm70a A G 16: 57,122,036 M59V probably benign Het
Trip12 A G 1: 84,749,298 S1184P probably damaging Het
Trrap A G 5: 144,791,115 S549G probably benign Het
Unc5d T A 8: 29,219,443 probably benign Het
Ush2a G A 1: 188,576,292 probably null Het
Usp45 T C 4: 21,784,755 V147A probably damaging Het
Vmn2r77 T A 7: 86,811,786 N773K probably damaging Het
Vps13c A T 9: 67,951,695 N2809I probably damaging Het
Yeats2 T A 16: 20,213,328 S984R possibly damaging Het
Yeats2 T A 16: 20,222,783 L1141Q probably damaging Het
Zfp58 T A 13: 67,491,275 T366S probably benign Het
Other mutations in Prph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Prph APN 15 99058636 missense possibly damaging 0.88
IGL01472:Prph APN 15 99058593 splice site probably benign
IGL01868:Prph APN 15 99056343 missense probably damaging 1.00
IGL02714:Prph APN 15 99056866 missense probably damaging 1.00
IGL02816:Prph APN 15 99057420 missense probably damaging 0.97
R0242:Prph UTSW 15 99055727 missense probably damaging 1.00
R0396:Prph UTSW 15 99056991 missense probably benign
R0441:Prph UTSW 15 99057438 missense probably damaging 1.00
R2065:Prph UTSW 15 99056133 missense probably damaging 1.00
R2326:Prph UTSW 15 99055282 unclassified probably benign
R3115:Prph UTSW 15 99055456 missense probably damaging 1.00
R4441:Prph UTSW 15 99057124 missense probably damaging 1.00
R4794:Prph UTSW 15 99057427 missense probably damaging 1.00
R5058:Prph UTSW 15 99055232 unclassified probably benign
R5463:Prph UTSW 15 99055400 missense probably benign 0.43
R6199:Prph UTSW 15 99056832 missense probably benign 0.33
R6242:Prph UTSW 15 99057123 missense probably damaging 0.99
R6502:Prph UTSW 15 99056386 missense probably damaging 1.00
R7356:Prph UTSW 15 99056926 missense probably damaging 1.00
R7818:Prph UTSW 15 99057872 missense probably damaging 1.00
R8353:Prph UTSW 15 99056776 missense probably benign 0.02
R8453:Prph UTSW 15 99056776 missense probably benign 0.02
Z1177:Prph UTSW 15 99056380 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAAAACCCTTCCGACTGCC -3'
(R):5'- ACAATCAGAACAATCGGGGC -3'

Sequencing Primer
(F):5'- AATGAGGCGCTGCTCAGAC -3'
(R):5'- TCAGAACAATCGGGGCAGGAG -3'
Posted On 2022-04-18