Mutagenetix > Incidental Mutations

Incidental Mutation 'R0742:Xpo1'

70736

Institutional Source

Beutler Lab

Gene Symbol

Xpo1

Ensembl Gene

ENSMUSG00000020290

Gene Name

exportin 1

Synonyms

Crm1

MMRRC Submission

038923-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0742 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23256041-23298249 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23294682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1020 (V1020A)

Ref Sequence

ENSEMBL: ENSMUSP00000105178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]

AlphaFold

Q6P5F9

PDB Structure

Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020538
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: V1020A

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102869
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: V1020A

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	7.4e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102870
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: V1020A

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109551
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: V1020A

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Meta Mutation Damage Score

0.9287

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	A	6: 58,678,326	D415E	probably benign	Het
Aff3	A	G	1: 38,627,108	W12R	probably damaging	Het
Aldh3b2	G	A	19: 3,981,034	G428S	probably damaging	Het
Arhgef10l	A	G	4: 140,536,845	L736P	probably damaging	Het
Baz2a	G	T	10: 128,113,666	E374*	probably null	Het
BC005561	G	A	5: 104,522,154	S1514N	probably benign	Het
Casd1	T	C	6: 4,635,888		probably null	Het
Cct2	A	T	10: 117,055,246		probably null	Het
Cdc42bpg	G	A	19: 6,318,575		probably null	Het
Copg2	T	C	6: 30,863,613		probably null	Het
Fbxw15	C	T	9: 109,555,556		probably null	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lyz1	A	T	10: 117,289,117		probably null	Het
Mroh3	A	T	1: 136,190,980	I533N	probably damaging	Het
Otogl	A	G	10: 107,866,740	V684A	possibly damaging	Het
Pcdh15	A	G	10: 74,621,297	D1302G	probably damaging	Het
Plec	A	T	15: 76,172,783	I4183N	probably damaging	Het
Rpe	C	T	1: 66,715,141	T124I	probably benign	Het
Rufy4	T	C	1: 74,146,716	I514T	probably benign	Het
Scap	T	A	9: 110,381,259	L912Q	probably damaging	Het
Sec61a2	T	C	2: 5,876,548	D264G	probably benign	Het
Slc4a3	T	A	1: 75,556,081	I995K	probably damaging	Het
Sptbn2	T	C	19: 4,718,983	I48T	possibly damaging	Het
Steap3	C	T	1: 120,241,583	R328H	possibly damaging	Het
Tmprss13	T	C	9: 45,332,467	F167S	probably damaging	Het
Ttc3	G	A	16: 94,459,880	C1408Y	probably benign	Het
Twf1	A	G	15: 94,585,530	M99T	probably damaging	Het
Unc80	A	G	1: 66,527,893	N886S	possibly damaging	Het
Vmn2r12	T	A	5: 109,086,415	T644S	possibly damaging	Het
Vps13b	A	G	15: 35,794,361	S2306G	probably benign	Het
Ylpm1	T	A	12: 85,029,112	N870K	probably benign	Het

Other mutations in Xpo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Xpo1	APN	11	23285094	missense	probably damaging	1.00
IGL01464:Xpo1	APN	11	23267703	missense	probably damaging	0.97
IGL01561:Xpo1	APN	11	23282706	missense	possibly damaging	0.76
IGL01630:Xpo1	APN	11	23285846	missense	probably benign	0.00
IGL01700:Xpo1	APN	11	23276422	splice site	probably benign
IGL02000:Xpo1	APN	11	23296003	missense	probably damaging	1.00
IGL02299:Xpo1	APN	11	23293915	splice site	probably benign
IGL02313:Xpo1	APN	11	23277065	missense	probably damaging	1.00
IGL02828:Xpo1	APN	11	23282593	missense	probably damaging	0.97
IGL03210:Xpo1	APN	11	23278834	missense	probably benign	0.01
IGL03329:Xpo1	APN	11	23284306	missense	probably benign
PIT1430001:Xpo1	UTSW	11	23276437	missense	possibly damaging	0.66
R0507:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R0594:Xpo1	UTSW	11	23280402	missense	probably damaging	1.00
R0706:Xpo1	UTSW	11	23280441	missense	probably benign	0.09
R1385:Xpo1	UTSW	11	23261863	missense	probably damaging	0.96
R1478:Xpo1	UTSW	11	23291623	missense	probably damaging	0.99
R1483:Xpo1	UTSW	11	23284863	missense	probably benign	0.04
R1694:Xpo1	UTSW	11	23281399	missense	probably benign	0.12
R1775:Xpo1	UTSW	11	23271193	missense	probably benign
R1827:Xpo1	UTSW	11	23285155	missense	probably benign	0.00
R2262:Xpo1	UTSW	11	23284634	splice site	probably null
R2263:Xpo1	UTSW	11	23284634	splice site	probably null
R4510:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4511:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4840:Xpo1	UTSW	11	23278183	missense	probably damaging	1.00
R4901:Xpo1	UTSW	11	23281327	missense	possibly damaging	0.62
R5176:Xpo1	UTSW	11	23295977	missense	probably damaging	0.99
R5508:Xpo1	UTSW	11	23294645	missense	probably benign
R5927:Xpo1	UTSW	11	23268653	unclassified	probably benign
R5927:Xpo1	UTSW	11	23268656	unclassified	probably benign
R6110:Xpo1	UTSW	11	23287434	missense	probably damaging	0.99
R6421:Xpo1	UTSW	11	23291490	missense	possibly damaging	0.60
R6591:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6691:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6698:Xpo1	UTSW	11	23294040	missense	probably benign	0.01
R6958:Xpo1	UTSW	11	23285855	missense	probably benign
R7407:Xpo1	UTSW	11	23285823	missense	probably damaging	1.00
R7482:Xpo1	UTSW	11	23282544	missense	probably benign	0.00
R7624:Xpo1	UTSW	11	23282584	missense	probably damaging	0.99
R8335:Xpo1	UTSW	11	23280603	splice site	probably null
R8823:Xpo1	UTSW	11	23267752	missense	probably benign
R9128:Xpo1	UTSW	11	23285058	missense	probably damaging	1.00
R9232:Xpo1	UTSW	11	23282646	missense	probably benign
R9277:Xpo1	UTSW	11	23291550	missense	probably benign	0.17
Z1176:Xpo1	UTSW	11	23296080	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCCGTAATGGACCCTAGATCACC -3'
(R):5'- GGAGGCCAATAGAATGCTTGCCTG -3'

Sequencing Primer
(F):5'- TTAGAGGCTGAGCCATCTGC -3'
(R):5'- GCTTGCCTGTTTAAAAAAAACACTTG -3'

Posted On

2013-09-30