Incidental Mutation 'R0742:Xpo1'
ID 70736
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Name exportin 1
Synonyms Crm1
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0742 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256041-23298249 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23294682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1020 (V1020A)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]
AlphaFold Q6P5F9
PDB Structure Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020538
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102869
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102870
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109551
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Meta Mutation Damage Score 0.9287 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0507:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 splice site probably null
R2263:Xpo1 UTSW 11 23284634 splice site probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
R8335:Xpo1 UTSW 11 23280603 splice site probably null
R8823:Xpo1 UTSW 11 23267752 missense probably benign
R9128:Xpo1 UTSW 11 23285058 missense probably damaging 1.00
R9232:Xpo1 UTSW 11 23282646 missense probably benign
R9277:Xpo1 UTSW 11 23291550 missense probably benign 0.17
Z1176:Xpo1 UTSW 11 23296080 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCCGTAATGGACCCTAGATCACC -3'
(R):5'- GGAGGCCAATAGAATGCTTGCCTG -3'

Sequencing Primer
(F):5'- TTAGAGGCTGAGCCATCTGC -3'
(R):5'- GCTTGCCTGTTTAAAAAAAACACTTG -3'
Posted On 2013-09-30