Incidental Mutation 'R9339:Thap12'
ID 707376
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R9339 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98715116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 164 (S164P)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect possibly damaging
Transcript: ENSMUST00000033009
AA Change: S164P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: S164P

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,849,657 E304G unknown Het
4933425L06Rik C T 13: 105,109,606 T225I probably benign Het
4933436I01Rik T A X: 67,921,083 K57* probably null Het
Aar2 T C 2: 156,550,973 V94A probably benign Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Adam25 T C 8: 40,753,874 V59A probably damaging Het
Ampd2 T C 3: 108,080,300 D103G probably damaging Het
Ankrd12 A G 17: 65,984,413 S1342P probably benign Het
Atp13a2 A G 4: 141,003,260 T739A probably benign Het
Catsperg1 T A 7: 29,195,460 N571Y probably benign Het
Cela3b A G 4: 137,425,044 I74T probably damaging Het
Cfhr1 A G 1: 139,557,555 L51P probably benign Het
Ckap5 T A 2: 91,565,755 D534E probably benign Het
Cstf3 C T 2: 104,663,433 P594L probably damaging Het
Ctdp1 A G 18: 80,449,474 L602P probably damaging Het
Defa24 A G 8: 21,734,543 T3A probably damaging Het
Dmgdh A G 13: 93,711,433 H546R probably benign Het
Dscam A G 16: 96,716,063 V882A possibly damaging Het
Dydc2 A G 14: 41,049,303 *140Q probably null Het
Ehd4 T C 2: 120,091,227 D516G possibly damaging Het
En1 T C 1: 120,607,164 V394A unknown Het
Erich3 T G 3: 154,763,235 L1108R unknown Het
Erp27 A G 6: 136,919,947 S86P probably benign Het
Esr1 A C 10: 4,746,798 S216R probably damaging Het
Fbxo40 A T 16: 36,968,924 I608N probably damaging Het
Fcna G A 2: 25,627,770 Q23* probably null Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gata6 A G 18: 11,054,520 T150A probably damaging Het
Gbp2b T A 3: 142,611,417 H511Q probably benign Het
Gm4788 T A 1: 139,754,306 Y184F probably benign Het
Gpr171 C A 3: 59,097,941 V138L probably damaging Het
Grhl2 G A 15: 37,344,660 V509I probably benign Het
Gzmd G A 14: 56,130,412 P135S probably damaging Het
Hhatl C A 9: 121,789,796 C90F probably benign Het
Hspg2 A G 4: 137,551,169 K3050R probably benign Het
Kcnh3 T C 15: 99,232,905 Y468H probably damaging Het
Lhfp A G 3: 53,043,470 H55R probably benign Het
Lpgat1 T C 1: 191,719,376 V38A probably benign Het
Lrrc49 A G 9: 60,602,748 I479T probably benign Het
Map1b A T 13: 99,431,062 I1717N unknown Het
Map3k20 G T 2: 72,441,872 R781S possibly damaging Het
Mcm3ap A G 10: 76,470,524 E157G probably benign Het
Mylk2 A G 2: 152,913,450 E178G probably damaging Het
Naaladl2 A G 3: 24,002,982 L605P probably damaging Het
Nox4 G A 7: 87,376,240 R525Q probably benign Het
Olfr1249 T C 2: 89,630,211 E229G probably damaging Het
Olfr63 T C 17: 33,269,657 V311A probably benign Het
Padi3 A T 4: 140,795,617 I348N probably benign Het
Pcdh18 T C 3: 49,754,886 D660G probably damaging Het
Pdgfra T A 5: 75,194,974 S1048R probably damaging Het
Pkhd1l1 T C 15: 44,589,553 V3958A probably damaging Het
Ppargc1b C A 18: 61,323,196 C80F probably damaging Het
Rbm28 T C 6: 29,128,675 E590G probably benign Het
Rbm47 T C 5: 66,026,483 E259G possibly damaging Het
Rint1 A G 5: 23,788,357 *37W probably null Het
Sacs G A 14: 61,205,860 R1785Q probably benign Het
Samm50 T C 15: 84,211,075 C421R probably benign Het
Scnn1b G T 7: 121,912,031 A314S probably damaging Het
Sf3b3 C A 8: 110,816,222 V868L probably benign Het
Sirt5 G T 13: 43,376,851 V136L probably benign Het
Slc1a7 T C 4: 107,993,040 V116A probably damaging Het
Slc24a4 G A 12: 102,264,379 V510M probably damaging Het
Spata4 T C 8: 54,600,864 S22P probably benign Het
Sqstm1 A G 11: 50,200,898 V324A probably benign Het
Stmnd1 G A 13: 46,299,603 A252T probably benign Het
Tbl1xr1 C A 3: 22,203,986 N470K possibly damaging Het
Thsd1 A G 8: 22,243,882 Y315C probably damaging Het
Tnni2 C A 7: 142,443,935 D102E probably damaging Het
Trav7n-4 A C 14: 53,091,392 N16T probably benign Het
Trpm7 T C 2: 126,823,986 K900R probably benign Het
Tspoap1 T A 11: 87,778,013 C1371S probably benign Het
Tssk5 A G 15: 76,372,956 M242T possibly damaging Het
Ubn2 A G 6: 38,483,144 I607V probably benign Het
Ubr2 A T 17: 46,973,939 V551E probably benign Het
Vipr2 A G 12: 116,094,724 N87S probably damaging Het
Vmn2r18 T A 5: 151,561,667 K787N probably damaging Het
Wwc2 A T 8: 47,900,824 W92R probably damaging Het
Zfp141 A G 7: 42,476,215 Y278H probably damaging Het
Zfp827 T C 8: 79,118,258 S686P probably benign Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R8897:Thap12 UTSW 7 98715327 missense probably benign 0.38
R9099:Thap12 UTSW 7 98715393 missense probably damaging 1.00
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9467:Thap12 UTSW 7 98710141 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTGTCTGCAGCATTTGTCC -3'
(R):5'- AATGTGTTGACCGCTGTGGC -3'

Sequencing Primer
(F):5'- ATGTTCTATTAGTGGTGAATGAATGC -3'
(R):5'- GGCCTCAAAGCGCTTCCTTAG -3'
Posted On 2022-04-18