Incidental Mutation 'R9341:Cacna2d3'
ID 707508
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9341 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28704315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 822 (M822K)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567]
AlphaFold Q9Z1L5
Predicted Effect possibly damaging
Transcript: ENSMUST00000022567
AA Change: M822K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: M822K

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat2 T C 17: 13,167,538 (GRCm39) N166S probably damaging Het
Agap2 G C 10: 126,927,559 (GRCm39) G1147R unknown Het
Atp8b2 A T 3: 89,855,811 (GRCm39) F446I possibly damaging Het
Caskin1 A G 17: 24,723,447 (GRCm39) E745G probably damaging Het
Clec4a2 G T 6: 123,104,955 (GRCm39) A82S probably benign Het
Col5a3 T C 9: 20,704,909 (GRCm39) N749S unknown Het
Col9a2 T A 4: 120,911,483 (GRCm39) M608K probably benign Het
Cope T C 8: 70,761,228 (GRCm39) probably null Het
Dennd2d T A 3: 106,397,730 (GRCm39) probably null Het
Dpys T C 15: 39,656,748 (GRCm39) T440A possibly damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln5 G A 12: 101,737,551 (GRCm39) T152I probably damaging Het
Gm16503 A T 4: 147,625,508 (GRCm39) M1L unknown Het
Gm9195 A G 14: 72,717,500 (GRCm39) S278P probably damaging Het
Hmcn2 A G 2: 31,279,359 (GRCm39) N1787S probably benign Het
Klhl33 A G 14: 51,133,903 (GRCm39) probably null Het
Lrrk2 A G 15: 91,584,618 (GRCm39) D345G probably benign Het
Man2b2 A G 5: 36,975,951 (GRCm39) L368P probably damaging Het
Med23 T A 10: 24,788,705 (GRCm39) S1371T probably benign Het
Mllt3 T A 4: 87,792,168 (GRCm39) E109D possibly damaging Het
Myom2 G A 8: 15,134,633 (GRCm39) D479N probably damaging Het
Or52r1c A T 7: 102,735,324 (GRCm39) R195* probably null Het
Pcdhga10 G T 18: 37,880,532 (GRCm39) A98S probably benign Het
Pde8a A T 7: 80,950,427 (GRCm39) Q221H probably benign Het
Pkd1l1 T C 11: 8,786,399 (GRCm39) H2335R Het
Pkd1l1 T A 11: 8,911,305 (GRCm39) D324V Het
Pou2f2 G A 7: 24,794,277 (GRCm39) T363I possibly damaging Het
Prlr A G 15: 10,328,988 (GRCm39) I488V probably benign Het
Psmd2 T C 16: 20,475,441 (GRCm39) probably null Het
Rbm7 T C 9: 48,400,969 (GRCm39) D253G probably damaging Het
Ros1 A G 10: 51,972,116 (GRCm39) probably null Het
S1pr3 G T 13: 51,573,553 (GRCm39) V245L probably damaging Het
Sacs A G 14: 61,446,219 (GRCm39) D2755G probably benign Het
Scgn T A 13: 24,173,829 (GRCm39) probably null Het
Sh3rf3 A G 10: 58,966,802 (GRCm39) K715E probably damaging Het
Sox18 T C 2: 181,312,231 (GRCm39) E300G probably damaging Het
Spef2 T A 15: 9,713,190 (GRCm39) N394I probably damaging Het
Strn4 T C 7: 16,573,827 (GRCm39) F759L probably damaging Het
Tas2r144 A T 6: 42,193,066 (GRCm39) I269F probably benign Het
Tpcn1 T C 5: 120,678,737 (GRCm39) D606G possibly damaging Het
Trh A G 6: 92,220,823 (GRCm39) I13T probably benign Het
Umodl1 T C 17: 31,217,701 (GRCm39) I1169T possibly damaging Het
Vwa3b G A 1: 37,153,615 (GRCm39) D486N probably damaging Het
Wars2 T C 3: 99,094,846 (GRCm39) L47P probably benign Het
Zbtb14 A G 17: 69,695,576 (GRCm39) S425G probably damaging Het
Zdhhc16 T C 19: 41,926,549 (GRCm39) S111P probably benign Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGGTATCAAACATGCTGACAGCC -3'
(R):5'- CTGGAACTCTGGAAAATCATGGG -3'

Sequencing Primer
(F):5'- GGTAATCCAAGGAGCTGGCAATTC -3'
(R):5'- ACTCTGGAAAATCATGGGTGTATG -3'
Posted On 2022-04-18