Incidental Mutation 'R9341:Spef2'
ID 707512
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Name sperm flagellar 2
Synonyms C230086A09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9341 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 9578279-9748954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9713190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 394 (N394I)
Ref Sequence ENSEMBL: ENSMUSP00000035762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
AlphaFold Q8C9J3
Predicted Effect probably damaging
Transcript: ENSMUST00000041840
AA Change: N394I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: N394I

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159093
AA Change: N451I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: N451I

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159368
AA Change: N394I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: N394I

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160236
AA Change: N394I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: N394I

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162780
AA Change: N451I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: N451I

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: N394I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat2 T C 17: 13,167,538 (GRCm39) N166S probably damaging Het
Agap2 G C 10: 126,927,559 (GRCm39) G1147R unknown Het
Atp8b2 A T 3: 89,855,811 (GRCm39) F446I possibly damaging Het
Cacna2d3 A T 14: 28,704,315 (GRCm39) M822K possibly damaging Het
Caskin1 A G 17: 24,723,447 (GRCm39) E745G probably damaging Het
Clec4a2 G T 6: 123,104,955 (GRCm39) A82S probably benign Het
Col5a3 T C 9: 20,704,909 (GRCm39) N749S unknown Het
Col9a2 T A 4: 120,911,483 (GRCm39) M608K probably benign Het
Cope T C 8: 70,761,228 (GRCm39) probably null Het
Dennd2d T A 3: 106,397,730 (GRCm39) probably null Het
Dpys T C 15: 39,656,748 (GRCm39) T440A possibly damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln5 G A 12: 101,737,551 (GRCm39) T152I probably damaging Het
Gm16503 A T 4: 147,625,508 (GRCm39) M1L unknown Het
Gm9195 A G 14: 72,717,500 (GRCm39) S278P probably damaging Het
Hmcn2 A G 2: 31,279,359 (GRCm39) N1787S probably benign Het
Klhl33 A G 14: 51,133,903 (GRCm39) probably null Het
Lrrk2 A G 15: 91,584,618 (GRCm39) D345G probably benign Het
Man2b2 A G 5: 36,975,951 (GRCm39) L368P probably damaging Het
Med23 T A 10: 24,788,705 (GRCm39) S1371T probably benign Het
Mllt3 T A 4: 87,792,168 (GRCm39) E109D possibly damaging Het
Myom2 G A 8: 15,134,633 (GRCm39) D479N probably damaging Het
Or52r1c A T 7: 102,735,324 (GRCm39) R195* probably null Het
Pcdhga10 G T 18: 37,880,532 (GRCm39) A98S probably benign Het
Pde8a A T 7: 80,950,427 (GRCm39) Q221H probably benign Het
Pkd1l1 T C 11: 8,786,399 (GRCm39) H2335R Het
Pkd1l1 T A 11: 8,911,305 (GRCm39) D324V Het
Pou2f2 G A 7: 24,794,277 (GRCm39) T363I possibly damaging Het
Prlr A G 15: 10,328,988 (GRCm39) I488V probably benign Het
Psmd2 T C 16: 20,475,441 (GRCm39) probably null Het
Rbm7 T C 9: 48,400,969 (GRCm39) D253G probably damaging Het
Ros1 A G 10: 51,972,116 (GRCm39) probably null Het
S1pr3 G T 13: 51,573,553 (GRCm39) V245L probably damaging Het
Sacs A G 14: 61,446,219 (GRCm39) D2755G probably benign Het
Scgn T A 13: 24,173,829 (GRCm39) probably null Het
Sh3rf3 A G 10: 58,966,802 (GRCm39) K715E probably damaging Het
Sox18 T C 2: 181,312,231 (GRCm39) E300G probably damaging Het
Strn4 T C 7: 16,573,827 (GRCm39) F759L probably damaging Het
Tas2r144 A T 6: 42,193,066 (GRCm39) I269F probably benign Het
Tpcn1 T C 5: 120,678,737 (GRCm39) D606G possibly damaging Het
Trh A G 6: 92,220,823 (GRCm39) I13T probably benign Het
Umodl1 T C 17: 31,217,701 (GRCm39) I1169T possibly damaging Het
Vwa3b G A 1: 37,153,615 (GRCm39) D486N probably damaging Het
Wars2 T C 3: 99,094,846 (GRCm39) L47P probably benign Het
Zbtb14 A G 17: 69,695,576 (GRCm39) S425G probably damaging Het
Zdhhc16 T C 19: 41,926,549 (GRCm39) S111P probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9,740,621 (GRCm39) missense probably damaging 1.00
IGL00886:Spef2 APN 15 9,663,181 (GRCm39) missense probably damaging 1.00
IGL01409:Spef2 APN 15 9,716,499 (GRCm39) missense probably damaging 1.00
IGL01413:Spef2 APN 15 9,676,376 (GRCm39) missense probably benign 0.16
IGL01474:Spef2 APN 15 9,663,244 (GRCm39) missense probably benign 0.00
IGL01603:Spef2 APN 15 9,704,466 (GRCm39) missense probably damaging 0.99
IGL02320:Spef2 APN 15 9,717,662 (GRCm39) missense probably damaging 0.99
IGL02570:Spef2 APN 15 9,717,584 (GRCm39) nonsense probably null
IGL02605:Spef2 APN 15 9,725,238 (GRCm39) missense probably damaging 0.99
IGL02890:Spef2 APN 15 9,748,853 (GRCm39) start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9,679,432 (GRCm39) missense probably damaging 1.00
IGL02942:Spef2 APN 15 9,668,960 (GRCm39) missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9,713,329 (GRCm39) missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9,725,192 (GRCm39) splice site probably benign
IGL03263:Spef2 APN 15 9,667,305 (GRCm39) missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9,676,466 (GRCm39) missense probably benign 0.01
R0101:Spef2 UTSW 15 9,713,194 (GRCm39) missense probably damaging 1.00
R0101:Spef2 UTSW 15 9,713,194 (GRCm39) missense probably damaging 1.00
R0183:Spef2 UTSW 15 9,716,445 (GRCm39) missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9,584,148 (GRCm39) missense probably damaging 1.00
R0511:Spef2 UTSW 15 9,584,070 (GRCm39) critical splice donor site probably null
R0617:Spef2 UTSW 15 9,592,844 (GRCm39) missense probably damaging 1.00
R0655:Spef2 UTSW 15 9,626,217 (GRCm39) missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9,687,899 (GRCm39) missense probably benign 0.10
R0908:Spef2 UTSW 15 9,614,281 (GRCm39) splice site probably null
R0939:Spef2 UTSW 15 9,704,636 (GRCm39) splice site probably null
R0973:Spef2 UTSW 15 9,716,482 (GRCm39) missense probably damaging 1.00
R1371:Spef2 UTSW 15 9,725,194 (GRCm39) splice site probably benign
R1392:Spef2 UTSW 15 9,647,349 (GRCm39) missense probably benign 0.15
R1392:Spef2 UTSW 15 9,647,349 (GRCm39) missense probably benign 0.15
R1428:Spef2 UTSW 15 9,596,793 (GRCm39) unclassified probably benign
R1518:Spef2 UTSW 15 9,667,316 (GRCm39) missense probably damaging 1.00
R1585:Spef2 UTSW 15 9,596,660 (GRCm39) missense probably damaging 1.00
R1654:Spef2 UTSW 15 9,634,738 (GRCm39) missense probably damaging 0.99
R1723:Spef2 UTSW 15 9,614,295 (GRCm39) missense probably damaging 1.00
R1757:Spef2 UTSW 15 9,717,568 (GRCm39) missense probably damaging 1.00
R1812:Spef2 UTSW 15 9,679,435 (GRCm39) missense probably damaging 1.00
R1817:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1818:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1873:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1875:Spef2 UTSW 15 9,597,487 (GRCm39) missense possibly damaging 0.78
R1875:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1897:Spef2 UTSW 15 9,729,740 (GRCm39) nonsense probably null
R1901:Spef2 UTSW 15 9,607,463 (GRCm39) missense probably damaging 1.00
R1902:Spef2 UTSW 15 9,607,463 (GRCm39) missense probably damaging 1.00
R1943:Spef2 UTSW 15 9,663,280 (GRCm39) missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9,609,602 (GRCm39) missense probably damaging 1.00
R1973:Spef2 UTSW 15 9,663,152 (GRCm39) makesense probably null
R1998:Spef2 UTSW 15 9,668,989 (GRCm39) critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9,668,989 (GRCm39) critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9,713,271 (GRCm39) missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9,589,659 (GRCm39) missense probably damaging 1.00
R2127:Spef2 UTSW 15 9,729,747 (GRCm39) missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9,626,120 (GRCm39) nonsense probably null
R2517:Spef2 UTSW 15 9,725,283 (GRCm39) missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9,630,699 (GRCm39) missense probably damaging 0.99
R2988:Spef2 UTSW 15 9,682,709 (GRCm39) missense probably benign 0.43
R3792:Spef2 UTSW 15 9,704,622 (GRCm39) missense probably damaging 1.00
R4154:Spef2 UTSW 15 9,626,107 (GRCm39) missense probably benign 0.13
R4159:Spef2 UTSW 15 9,676,407 (GRCm39) missense probably damaging 1.00
R4199:Spef2 UTSW 15 9,667,366 (GRCm39) missense probably damaging 1.00
R4320:Spef2 UTSW 15 9,679,429 (GRCm39) missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9,679,429 (GRCm39) missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9,647,303 (GRCm39) missense probably damaging 1.00
R4625:Spef2 UTSW 15 9,647,524 (GRCm39) missense probably damaging 1.00
R4669:Spef2 UTSW 15 9,676,459 (GRCm39) missense probably benign 0.42
R4684:Spef2 UTSW 15 9,647,576 (GRCm39) missense probably benign 0.44
R4761:Spef2 UTSW 15 9,653,040 (GRCm39) missense probably damaging 1.00
R4839:Spef2 UTSW 15 9,713,264 (GRCm39) nonsense probably null
R5004:Spef2 UTSW 15 9,578,413 (GRCm39) missense probably benign 0.02
R5157:Spef2 UTSW 15 9,668,877 (GRCm39) nonsense probably null
R5230:Spef2 UTSW 15 9,667,316 (GRCm39) missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9,596,777 (GRCm39) missense probably damaging 0.98
R5400:Spef2 UTSW 15 9,614,367 (GRCm39) missense probably damaging 1.00
R5591:Spef2 UTSW 15 9,583,922 (GRCm39) missense probably benign 0.02
R5599:Spef2 UTSW 15 9,729,789 (GRCm39) missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9,609,606 (GRCm39) missense probably damaging 0.96
R5787:Spef2 UTSW 15 9,748,812 (GRCm39) missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9,614,301 (GRCm39) missense probably benign 0.16
R6177:Spef2 UTSW 15 9,727,618 (GRCm39) missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9,626,059 (GRCm39) missense probably damaging 1.00
R6665:Spef2 UTSW 15 9,600,604 (GRCm39) critical splice donor site probably null
R6944:Spef2 UTSW 15 9,592,835 (GRCm39) missense probably damaging 1.00
R6956:Spef2 UTSW 15 9,685,021 (GRCm39) missense probably damaging 1.00
R6968:Spef2 UTSW 15 9,597,426 (GRCm39) missense probably benign 0.02
R7089:Spef2 UTSW 15 9,725,257 (GRCm39) missense probably damaging 1.00
R7117:Spef2 UTSW 15 9,729,924 (GRCm39) missense probably damaging 1.00
R7161:Spef2 UTSW 15 9,717,689 (GRCm39) missense probably benign 0.29
R7223:Spef2 UTSW 15 9,601,726 (GRCm39) missense unknown
R7263:Spef2 UTSW 15 9,653,098 (GRCm39) splice site probably null
R7270:Spef2 UTSW 15 9,600,066 (GRCm39) critical splice donor site probably null
R7303:Spef2 UTSW 15 9,647,576 (GRCm39) missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9,584,293 (GRCm39) missense probably benign 0.02
R7464:Spef2 UTSW 15 9,740,671 (GRCm39) missense probably benign 0.23
R7498:Spef2 UTSW 15 9,727,625 (GRCm39) missense probably benign
R7587:Spef2 UTSW 15 9,713,305 (GRCm39) missense probably damaging 1.00
R7748:Spef2 UTSW 15 9,653,031 (GRCm39) missense probably damaging 0.98
R7772:Spef2 UTSW 15 9,704,567 (GRCm39) missense probably damaging 0.99
R7838:Spef2 UTSW 15 9,609,637 (GRCm39) missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9,596,730 (GRCm39) missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9,687,981 (GRCm39) missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9,717,649 (GRCm39) missense probably damaging 1.00
R7943:Spef2 UTSW 15 9,601,171 (GRCm39) missense unknown
R8105:Spef2 UTSW 15 9,682,748 (GRCm39) missense probably benign 0.06
R8151:Spef2 UTSW 15 9,601,598 (GRCm39) missense unknown
R8296:Spef2 UTSW 15 9,727,629 (GRCm39) missense probably benign 0.06
R8393:Spef2 UTSW 15 9,676,615 (GRCm39) missense probably benign 0.27
R8405:Spef2 UTSW 15 9,612,643 (GRCm39) missense probably benign 0.00
R8552:Spef2 UTSW 15 9,600,765 (GRCm39) intron probably benign
R8691:Spef2 UTSW 15 9,602,005 (GRCm39) nonsense probably null
R8751:Spef2 UTSW 15 9,729,723 (GRCm39) nonsense probably null
R8847:Spef2 UTSW 15 9,668,913 (GRCm39) missense probably benign
R8864:Spef2 UTSW 15 9,599,833 (GRCm39) missense unknown
R8868:Spef2 UTSW 15 9,729,747 (GRCm39) missense possibly damaging 0.53
R8916:Spef2 UTSW 15 9,725,266 (GRCm39) nonsense probably null
R8935:Spef2 UTSW 15 9,607,436 (GRCm39) missense probably damaging 0.98
R8961:Spef2 UTSW 15 9,647,414 (GRCm39) missense possibly damaging 0.92
R8978:Spef2 UTSW 15 9,725,263 (GRCm39) missense possibly damaging 0.81
R9062:Spef2 UTSW 15 9,601,717 (GRCm39) missense unknown
R9076:Spef2 UTSW 15 9,653,091 (GRCm39) missense probably benign 0.13
R9149:Spef2 UTSW 15 9,717,568 (GRCm39) missense probably damaging 1.00
R9162:Spef2 UTSW 15 9,602,017 (GRCm39) missense unknown
R9216:Spef2 UTSW 15 9,647,611 (GRCm39) missense probably damaging 1.00
R9240:Spef2 UTSW 15 9,578,401 (GRCm39) nonsense probably null
R9278:Spef2 UTSW 15 9,727,495 (GRCm39) critical splice donor site probably null
R9343:Spef2 UTSW 15 9,713,190 (GRCm39) missense probably damaging 1.00
R9389:Spef2 UTSW 15 9,725,307 (GRCm39) missense probably damaging 0.96
R9476:Spef2 UTSW 15 9,713,203 (GRCm39) missense probably damaging 1.00
R9510:Spef2 UTSW 15 9,713,203 (GRCm39) missense probably damaging 1.00
R9537:Spef2 UTSW 15 9,601,885 (GRCm39) missense unknown
R9575:Spef2 UTSW 15 9,596,672 (GRCm39) missense probably damaging 1.00
R9597:Spef2 UTSW 15 9,599,897 (GRCm39) missense unknown
R9765:Spef2 UTSW 15 9,601,945 (GRCm39) missense unknown
X0025:Spef2 UTSW 15 9,596,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGTCTATAGATTGCCCATAG -3'
(R):5'- TGCCAAACAAGCCAAGATTG -3'

Sequencing Primer
(F):5'- AGATTGCCCATAGATTGTGTCTC -3'
(R):5'- GCCAAACAAGCCAAGATTGATTTTGC -3'
Posted On 2022-04-18