Incidental Mutation 'R9342:Cubn'
ID 707530
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin
Synonyms D2Wsu88e, intrinsic factor-cobalamin receptor
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 13281149-13496624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13463767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 646 (D646V)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091436
AA Change: D646V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: D646V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik T C 5: 130,407,876 (GRCm39) I112V unknown Het
Aars2 A G 17: 45,818,002 (GRCm39) N75D possibly damaging Het
Abcf2 G A 5: 24,778,475 (GRCm39) R228C probably benign Het
Agfg2 A G 5: 137,652,114 (GRCm39) L415P probably benign Het
Alpi A G 1: 87,026,386 (GRCm39) L535P unknown Het
Anxa9 T G 3: 95,210,359 (GRCm39) T69P probably damaging Het
Arrb2 T A 11: 70,327,463 (GRCm39) D79E probably benign Het
Bcat1 A G 6: 144,994,332 (GRCm39) V55A probably benign Het
Cacna1c A G 6: 119,034,335 (GRCm39) L64P Het
Cd247 A T 1: 165,682,759 (GRCm39) D28V probably damaging Het
Celsr2 T A 3: 108,320,442 (GRCm39) N790I probably damaging Het
Clrn1 C T 3: 58,792,251 (GRCm39) V71I probably benign Het
Cmtr2 T C 8: 110,949,078 (GRCm39) Y463H possibly damaging Het
Col6a6 T C 9: 105,663,172 (GRCm39) T122A probably benign Het
Dab2ip T A 2: 35,613,105 (GRCm39) L1062Q possibly damaging Het
Dnajb4 T C 3: 151,892,272 (GRCm39) N187S probably benign Het
Dock10 A T 1: 80,570,360 (GRCm39) F365L probably benign Het
Erich6 G A 3: 58,534,101 (GRCm39) Q309* probably null Het
Ext1 T C 15: 53,208,524 (GRCm39) H79R probably benign Het
Fam187b T A 7: 30,677,185 (GRCm39) C231* probably null Het
Fbh1 T C 2: 11,754,414 (GRCm39) I775V probably benign Het
Fbxo15 T A 18: 84,983,609 (GRCm39) M319K unknown Het
Fbxo9 A T 9: 78,002,520 (GRCm39) M187K possibly damaging Het
Fer1l4 T C 2: 155,877,196 (GRCm39) D1113G probably benign Het
Fsip2 A T 2: 82,818,747 (GRCm39) T4827S possibly damaging Het
Gm49398 A T 13: 61,435,478 (GRCm39) L7Q probably damaging Het
H2-M10.4 A T 17: 36,771,285 (GRCm39) W298R probably damaging Het
Hoxd10 A G 2: 74,522,982 (GRCm39) E220G probably benign Het
Hrh2 T G 13: 54,368,222 (GRCm39) L66R probably damaging Het
Igf1r A G 7: 67,844,746 (GRCm39) T840A probably benign Het
Iqca1 A G 1: 90,072,688 (GRCm39) V64A probably damaging Het
Klc2 A G 19: 5,158,659 (GRCm39) S612P probably benign Het
Klf15 A G 6: 90,443,851 (GRCm39) E142G probably damaging Het
Krt40 T A 11: 99,429,579 (GRCm39) T332S probably damaging Het
Lrrc9 T C 12: 72,506,767 (GRCm39) F348S probably damaging Het
Lrrn4 T C 2: 132,712,290 (GRCm39) D511G probably benign Het
Lrtm2 T C 6: 119,297,934 (GRCm39) I36V probably benign Het
Lsm10 T C 4: 125,991,860 (GRCm39) L72P probably damaging Het
Mab21l3 T A 3: 101,742,519 (GRCm39) S14C possibly damaging Het
Map2k4 T C 11: 65,581,569 (GRCm39) K381R probably benign Het
Mcidas A G 13: 113,130,915 (GRCm39) D80G probably damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mga A G 2: 119,778,656 (GRCm39) D2067G probably benign Het
Ms4a19 T A 19: 11,119,775 (GRCm39) T52S possibly damaging Het
Msc G T 1: 14,825,707 (GRCm39) P89Q probably benign Het
Nalf1 C A 8: 9,821,006 (GRCm39) A5S probably damaging Het
Or14c44 A G 7: 86,062,430 (GRCm39) I287V probably benign Het
Or2d3c A T 7: 106,526,564 (GRCm39) I34N possibly damaging Het
Or5t7 A T 2: 86,507,494 (GRCm39) L61Q probably damaging Het
Plekhg6 T C 6: 125,340,023 (GRCm39) D779G probably damaging Het
Pnpla2 C A 7: 141,035,331 (GRCm39) Y44* probably null Het
Ppp1r17 T A 6: 56,003,524 (GRCm39) D112E probably damaging Het
Prdm2 A G 4: 142,861,478 (GRCm39) I604T probably damaging Het
Prkce A G 17: 86,781,877 (GRCm39) Y182C probably damaging Het
Prokr2 G A 2: 132,182,790 (GRCm39) S189F possibly damaging Het
Qser1 A T 2: 104,618,164 (GRCm39) S793T probably benign Het
Reck T C 4: 43,943,301 (GRCm39) F951S probably benign Het
Rev3l T C 10: 39,697,458 (GRCm39) S652P probably benign Het
Rtl1 A C 12: 109,558,884 (GRCm39) L985R probably damaging Het
Sardh T C 2: 27,120,869 (GRCm39) E385G possibly damaging Het
Sfmbt1 G T 14: 30,519,599 (GRCm39) W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 (GRCm38) C683* probably null Het
Slc51a A G 16: 32,298,517 (GRCm39) L80P possibly damaging Het
Slco3a1 C A 7: 74,154,037 (GRCm39) L178F probably damaging Het
Spata6 T A 4: 111,636,389 (GRCm39) C227S possibly damaging Het
Tbc1d30 A T 10: 121,103,366 (GRCm39) Y555* probably null Het
Tcf7l2 A G 19: 55,731,517 (GRCm39) Q90R probably benign Het
Tff3 A C 17: 31,346,423 (GRCm39) S50A probably benign Het
Tnrc6c T C 11: 117,630,720 (GRCm39) M1027T probably benign Het
Ttc12 A G 9: 49,351,680 (GRCm39) F606L probably benign Het
Uqcc3 G A 19: 8,858,090 (GRCm39) Q34* probably null Het
Veph1 T A 3: 66,151,959 (GRCm39) I157F probably damaging Het
Vmn2r14 G A 5: 109,368,428 (GRCm39) T188I probably damaging Het
Vmn2r67 A G 7: 84,785,788 (GRCm39) I739T probably benign Het
Vmn2r68 A G 7: 84,882,993 (GRCm39) F253S probably benign Het
Vmn2r74 T C 7: 85,606,624 (GRCm39) I241V probably benign Het
Vmn2r97 A G 17: 19,149,368 (GRCm39) E252G probably benign Het
Vps13b T C 15: 35,455,200 (GRCm39) V703A possibly damaging Het
Vps25 T A 11: 101,149,623 (GRCm39) L149Q probably damaging Het
Xirp1 T C 9: 119,845,950 (GRCm39) T978A probably benign Het
Xpnpep1 T A 19: 52,993,248 (GRCm39) I360F probably benign Het
Zfpm1 C T 8: 123,061,308 (GRCm39) T291M probably benign Het
Zkscan8 A G 13: 21,710,702 (GRCm39) V136A probably benign Het
Zscan18 A G 7: 12,505,612 (GRCm39) Y592H probably damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,496,631 (GRCm39) unclassified probably benign
IGL00228:Cubn APN 2 13,461,508 (GRCm39) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,386,660 (GRCm39) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,431,867 (GRCm39) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,283,229 (GRCm39) missense probably benign 0.00
IGL00519:Cubn APN 2 13,287,730 (GRCm39) missense probably benign 0.00
IGL00562:Cubn APN 2 13,299,041 (GRCm39) missense probably benign 0.01
IGL00678:Cubn APN 2 13,472,521 (GRCm39) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,386,738 (GRCm39) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,461,434 (GRCm39) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,283,219 (GRCm39) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,482,904 (GRCm39) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,315,377 (GRCm39) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,470,719 (GRCm39) missense probably benign 0.31
IGL01418:Cubn APN 2 13,288,852 (GRCm39) missense probably benign 0.01
IGL01450:Cubn APN 2 13,355,673 (GRCm39) splice site probably benign
IGL01534:Cubn APN 2 13,470,744 (GRCm39) nonsense probably null
IGL01584:Cubn APN 2 13,313,472 (GRCm39) splice site probably benign
IGL01595:Cubn APN 2 13,330,027 (GRCm39) missense probably benign 0.05
IGL01625:Cubn APN 2 13,311,085 (GRCm39) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,494,747 (GRCm39) nonsense probably null
IGL01972:Cubn APN 2 13,450,883 (GRCm39) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,292,405 (GRCm39) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,344,657 (GRCm39) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,386,648 (GRCm39) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,432,645 (GRCm39) splice site probably null
IGL02491:Cubn APN 2 13,326,039 (GRCm39) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,330,037 (GRCm39) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,450,843 (GRCm39) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,449,851 (GRCm39) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,299,181 (GRCm39) missense probably benign 0.07
IGL02897:Cubn APN 2 13,323,123 (GRCm39) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,291,905 (GRCm39) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,360,500 (GRCm39) missense probably benign 0.09
IGL03289:Cubn APN 2 13,431,778 (GRCm39) missense probably benign 0.00
IGL03335:Cubn APN 2 13,365,140 (GRCm39) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,482,868 (GRCm39) splice site probably null
mellow UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,473,663 (GRCm39) nonsense probably null
PIT4495001:Cubn UTSW 2 13,496,561 (GRCm39) missense probably benign 0.00
R0145:Cubn UTSW 2 13,311,243 (GRCm39) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,361,520 (GRCm39) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,480,846 (GRCm39) critical splice donor site probably null
R0254:Cubn UTSW 2 13,445,325 (GRCm39) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,429,505 (GRCm39) missense probably benign 0.01
R0360:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0364:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0383:Cubn UTSW 2 13,435,770 (GRCm39) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,474,575 (GRCm39) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,474,574 (GRCm39) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,449,078 (GRCm39) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,433,491 (GRCm39) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,365,063 (GRCm39) splice site probably null
R0735:Cubn UTSW 2 13,496,500 (GRCm39) splice site probably benign
R0780:Cubn UTSW 2 13,461,424 (GRCm39) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,367,139 (GRCm39) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,341,053 (GRCm39) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,449,811 (GRCm39) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,365,130 (GRCm39) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,480,931 (GRCm39) missense probably benign 0.04
R1508:Cubn UTSW 2 13,431,916 (GRCm39) missense probably benign 0.25
R1532:Cubn UTSW 2 13,292,472 (GRCm39) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,432,778 (GRCm39) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,474,600 (GRCm39) missense probably benign 0.00
R1761:Cubn UTSW 2 13,494,128 (GRCm39) critical splice donor site probably null
R1862:Cubn UTSW 2 13,313,372 (GRCm39) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,327,813 (GRCm39) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,315,337 (GRCm39) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,283,349 (GRCm39) missense probably benign 0.01
R1960:Cubn UTSW 2 13,344,828 (GRCm39) splice site probably null
R2021:Cubn UTSW 2 13,313,360 (GRCm39) missense probably benign 0.09
R2137:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2138:Cubn UTSW 2 13,449,189 (GRCm39) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2179:Cubn UTSW 2 13,323,053 (GRCm39) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,408,891 (GRCm39) nonsense probably null
R2369:Cubn UTSW 2 13,496,028 (GRCm39) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,480,961 (GRCm39) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,323,083 (GRCm39) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,283,167 (GRCm39) splice site probably null
R2850:Cubn UTSW 2 13,327,764 (GRCm39) missense probably damaging 1.00
R2853:Cubn UTSW 2 13,435,645 (GRCm39) missense probably benign 0.00
R2893:Cubn UTSW 2 13,362,950 (GRCm39) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,362,973 (GRCm39) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,338,319 (GRCm39) missense probably benign 0.00
R3703:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,336,396 (GRCm39) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,432,725 (GRCm39) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,365,164 (GRCm39) missense probably benign 0.01
R3813:Cubn UTSW 2 13,299,136 (GRCm39) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,291,791 (GRCm39) critical splice donor site probably null
R3921:Cubn UTSW 2 13,331,488 (GRCm39) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,318,810 (GRCm39) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,433,374 (GRCm39) intron probably benign
R4405:Cubn UTSW 2 13,470,841 (GRCm39) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,433,560 (GRCm39) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,318,790 (GRCm39) splice site probably null
R4770:Cubn UTSW 2 13,319,578 (GRCm39) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,355,869 (GRCm39) missense probably damaging 1.00
R4799:Cubn UTSW 2 13,291,835 (GRCm39) missense possibly damaging 0.94
R4812:Cubn UTSW 2 13,463,887 (GRCm39) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,330,036 (GRCm39) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,494,721 (GRCm39) missense probably benign 0.06
R4967:Cubn UTSW 2 13,352,856 (GRCm39) missense probably benign 0.01
R5187:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,483,013 (GRCm39) nonsense probably null
R5305:Cubn UTSW 2 13,393,750 (GRCm39) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,496,506 (GRCm39) splice site probably null
R5530:Cubn UTSW 2 13,313,334 (GRCm39) missense probably damaging 1.00
R5531:Cubn UTSW 2 13,355,743 (GRCm39) missense probably benign 0.00
R5737:Cubn UTSW 2 13,393,702 (GRCm39) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,324,834 (GRCm39) splice site probably benign
R5923:Cubn UTSW 2 13,490,889 (GRCm39) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6084:Cubn UTSW 2 13,435,708 (GRCm39) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,313,429 (GRCm39) missense probably benign 0.29
R6181:Cubn UTSW 2 13,354,687 (GRCm39) missense probably benign 0.31
R6301:Cubn UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,285,006 (GRCm39) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,480,934 (GRCm39) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,435,806 (GRCm39) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,432,646 (GRCm39) critical splice donor site probably null
R6393:Cubn UTSW 2 13,360,491 (GRCm39) missense probably benign 0.08
R6408:Cubn UTSW 2 13,299,014 (GRCm39) missense probably damaging 1.00
R6470:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,463,813 (GRCm39) missense probably benign 0.01
R6599:Cubn UTSW 2 13,315,484 (GRCm39) missense possibly damaging 0.95
R6629:Cubn UTSW 2 13,435,683 (GRCm39) missense probably damaging 1.00
R6641:Cubn UTSW 2 13,480,875 (GRCm39) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,326,066 (GRCm39) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,449,840 (GRCm39) missense probably benign 0.21
R6847:Cubn UTSW 2 13,449,064 (GRCm39) critical splice donor site probably null
R6885:Cubn UTSW 2 13,323,089 (GRCm39) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,352,840 (GRCm39) missense probably benign 0.03
R6973:Cubn UTSW 2 13,386,648 (GRCm39) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,491,600 (GRCm39) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,311,092 (GRCm39) missense probably benign 0.10
R7076:Cubn UTSW 2 13,311,091 (GRCm39) missense probably benign 0.00
R7086:Cubn UTSW 2 13,324,669 (GRCm39) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,347,309 (GRCm39) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,355,814 (GRCm39) missense probably benign 0.01
R7292:Cubn UTSW 2 13,429,550 (GRCm39) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,345,143 (GRCm39) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,473,582 (GRCm39) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,291,875 (GRCm39) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,431,778 (GRCm39) missense probably benign 0.00
R7429:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,460,320 (GRCm39) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7700:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7751:Cubn UTSW 2 13,365,176 (GRCm39) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,284,889 (GRCm39) missense probably benign 0.11
R7759:Cubn UTSW 2 13,352,961 (GRCm39) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,473,680 (GRCm39) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,429,538 (GRCm39) missense probably benign 0.22
R7988:Cubn UTSW 2 13,337,166 (GRCm39) missense probably benign 0.43
R8010:Cubn UTSW 2 13,340,897 (GRCm39) critical splice donor site probably null
R8020:Cubn UTSW 2 13,483,989 (GRCm39) missense probably benign 0.01
R8120:Cubn UTSW 2 13,336,471 (GRCm39) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,393,659 (GRCm39) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,299,129 (GRCm39) missense probably benign 0.11
R8224:Cubn UTSW 2 13,354,688 (GRCm39) missense probably benign 0.16
R8289:Cubn UTSW 2 13,491,613 (GRCm39) missense probably benign 0.10
R8326:Cubn UTSW 2 13,311,274 (GRCm39) missense probably benign 0.01
R8331:Cubn UTSW 2 13,345,053 (GRCm39) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,435,658 (GRCm39) missense probably benign 0.08
R8341:Cubn UTSW 2 13,433,535 (GRCm39) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,329,971 (GRCm39) missense probably benign 0.17
R8427:Cubn UTSW 2 13,433,567 (GRCm39) missense probably benign 0.00
R8432:Cubn UTSW 2 13,386,610 (GRCm39) missense probably benign 0.00
R8441:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,318,855 (GRCm39) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,313,331 (GRCm39) critical splice donor site probably null
R8699:Cubn UTSW 2 13,388,770 (GRCm39) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,313,377 (GRCm39) nonsense probably null
R8874:Cubn UTSW 2 13,365,157 (GRCm39) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,461,466 (GRCm39) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,291,914 (GRCm39) missense probably benign 0.02
R9143:Cubn UTSW 2 13,337,276 (GRCm39) splice site probably benign
R9261:Cubn UTSW 2 13,283,262 (GRCm39) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,386,703 (GRCm39) missense probably damaging 1.00
R9603:Cubn UTSW 2 13,292,510 (GRCm39) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,482,945 (GRCm39) missense probably benign 0.00
R9615:Cubn UTSW 2 13,325,991 (GRCm39) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,319,529 (GRCm39) missense probably benign 0.04
R9774:Cubn UTSW 2 13,433,530 (GRCm39) missense probably benign
X0018:Cubn UTSW 2 13,463,797 (GRCm39) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,480,887 (GRCm39) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,347,392 (GRCm39) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,327,773 (GRCm39) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,388,803 (GRCm39) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,299,040 (GRCm39) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,386,636 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGAATTTCCAGTAAGAGACAG -3'
(R):5'- TTCAGAGTGTGGCGGCATAC -3'

Sequencing Primer
(F):5'- GATGCAAGGCAAGCTCTTCC -3'
(R):5'- CGGCATACTGACTGGTAATTATG -3'
Posted On 2022-04-18