Incidental Mutation 'R9342:Fer1l4'
ID 707540
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155877196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1113 (D1113G)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611] [ENSMUST00000130764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: D1113G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: D1113G

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130764
SMART Domains Protein: ENSMUSP00000114324
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
Blast:FerB 1 26 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132912
SMART Domains Protein: ENSMUSP00000123091
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik T C 5: 130,407,876 (GRCm39) I112V unknown Het
Aars2 A G 17: 45,818,002 (GRCm39) N75D possibly damaging Het
Abcf2 G A 5: 24,778,475 (GRCm39) R228C probably benign Het
Agfg2 A G 5: 137,652,114 (GRCm39) L415P probably benign Het
Alpi A G 1: 87,026,386 (GRCm39) L535P unknown Het
Anxa9 T G 3: 95,210,359 (GRCm39) T69P probably damaging Het
Arrb2 T A 11: 70,327,463 (GRCm39) D79E probably benign Het
Bcat1 A G 6: 144,994,332 (GRCm39) V55A probably benign Het
Cacna1c A G 6: 119,034,335 (GRCm39) L64P Het
Cd247 A T 1: 165,682,759 (GRCm39) D28V probably damaging Het
Celsr2 T A 3: 108,320,442 (GRCm39) N790I probably damaging Het
Clrn1 C T 3: 58,792,251 (GRCm39) V71I probably benign Het
Cmtr2 T C 8: 110,949,078 (GRCm39) Y463H possibly damaging Het
Col6a6 T C 9: 105,663,172 (GRCm39) T122A probably benign Het
Cubn T A 2: 13,463,767 (GRCm39) D646V probably damaging Het
Dab2ip T A 2: 35,613,105 (GRCm39) L1062Q possibly damaging Het
Dnajb4 T C 3: 151,892,272 (GRCm39) N187S probably benign Het
Dock10 A T 1: 80,570,360 (GRCm39) F365L probably benign Het
Erich6 G A 3: 58,534,101 (GRCm39) Q309* probably null Het
Ext1 T C 15: 53,208,524 (GRCm39) H79R probably benign Het
Fam187b T A 7: 30,677,185 (GRCm39) C231* probably null Het
Fbh1 T C 2: 11,754,414 (GRCm39) I775V probably benign Het
Fbxo15 T A 18: 84,983,609 (GRCm39) M319K unknown Het
Fbxo9 A T 9: 78,002,520 (GRCm39) M187K possibly damaging Het
Fsip2 A T 2: 82,818,747 (GRCm39) T4827S possibly damaging Het
Gm49398 A T 13: 61,435,478 (GRCm39) L7Q probably damaging Het
H2-M10.4 A T 17: 36,771,285 (GRCm39) W298R probably damaging Het
Hoxd10 A G 2: 74,522,982 (GRCm39) E220G probably benign Het
Hrh2 T G 13: 54,368,222 (GRCm39) L66R probably damaging Het
Igf1r A G 7: 67,844,746 (GRCm39) T840A probably benign Het
Iqca1 A G 1: 90,072,688 (GRCm39) V64A probably damaging Het
Klc2 A G 19: 5,158,659 (GRCm39) S612P probably benign Het
Klf15 A G 6: 90,443,851 (GRCm39) E142G probably damaging Het
Krt40 T A 11: 99,429,579 (GRCm39) T332S probably damaging Het
Lrrc9 T C 12: 72,506,767 (GRCm39) F348S probably damaging Het
Lrrn4 T C 2: 132,712,290 (GRCm39) D511G probably benign Het
Lrtm2 T C 6: 119,297,934 (GRCm39) I36V probably benign Het
Lsm10 T C 4: 125,991,860 (GRCm39) L72P probably damaging Het
Mab21l3 T A 3: 101,742,519 (GRCm39) S14C possibly damaging Het
Map2k4 T C 11: 65,581,569 (GRCm39) K381R probably benign Het
Mcidas A G 13: 113,130,915 (GRCm39) D80G probably damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mga A G 2: 119,778,656 (GRCm39) D2067G probably benign Het
Ms4a19 T A 19: 11,119,775 (GRCm39) T52S possibly damaging Het
Msc G T 1: 14,825,707 (GRCm39) P89Q probably benign Het
Nalf1 C A 8: 9,821,006 (GRCm39) A5S probably damaging Het
Or14c44 A G 7: 86,062,430 (GRCm39) I287V probably benign Het
Or2d3c A T 7: 106,526,564 (GRCm39) I34N possibly damaging Het
Or5t7 A T 2: 86,507,494 (GRCm39) L61Q probably damaging Het
Plekhg6 T C 6: 125,340,023 (GRCm39) D779G probably damaging Het
Pnpla2 C A 7: 141,035,331 (GRCm39) Y44* probably null Het
Ppp1r17 T A 6: 56,003,524 (GRCm39) D112E probably damaging Het
Prdm2 A G 4: 142,861,478 (GRCm39) I604T probably damaging Het
Prkce A G 17: 86,781,877 (GRCm39) Y182C probably damaging Het
Prokr2 G A 2: 132,182,790 (GRCm39) S189F possibly damaging Het
Qser1 A T 2: 104,618,164 (GRCm39) S793T probably benign Het
Reck T C 4: 43,943,301 (GRCm39) F951S probably benign Het
Rev3l T C 10: 39,697,458 (GRCm39) S652P probably benign Het
Rtl1 A C 12: 109,558,884 (GRCm39) L985R probably damaging Het
Sardh T C 2: 27,120,869 (GRCm39) E385G possibly damaging Het
Sfmbt1 G T 14: 30,519,599 (GRCm39) W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 (GRCm38) C683* probably null Het
Slc51a A G 16: 32,298,517 (GRCm39) L80P possibly damaging Het
Slco3a1 C A 7: 74,154,037 (GRCm39) L178F probably damaging Het
Spata6 T A 4: 111,636,389 (GRCm39) C227S possibly damaging Het
Tbc1d30 A T 10: 121,103,366 (GRCm39) Y555* probably null Het
Tcf7l2 A G 19: 55,731,517 (GRCm39) Q90R probably benign Het
Tff3 A C 17: 31,346,423 (GRCm39) S50A probably benign Het
Tnrc6c T C 11: 117,630,720 (GRCm39) M1027T probably benign Het
Ttc12 A G 9: 49,351,680 (GRCm39) F606L probably benign Het
Uqcc3 G A 19: 8,858,090 (GRCm39) Q34* probably null Het
Veph1 T A 3: 66,151,959 (GRCm39) I157F probably damaging Het
Vmn2r14 G A 5: 109,368,428 (GRCm39) T188I probably damaging Het
Vmn2r67 A G 7: 84,785,788 (GRCm39) I739T probably benign Het
Vmn2r68 A G 7: 84,882,993 (GRCm39) F253S probably benign Het
Vmn2r74 T C 7: 85,606,624 (GRCm39) I241V probably benign Het
Vmn2r97 A G 17: 19,149,368 (GRCm39) E252G probably benign Het
Vps13b T C 15: 35,455,200 (GRCm39) V703A possibly damaging Het
Vps25 T A 11: 101,149,623 (GRCm39) L149Q probably damaging Het
Xirp1 T C 9: 119,845,950 (GRCm39) T978A probably benign Het
Xpnpep1 T A 19: 52,993,248 (GRCm39) I360F probably benign Het
Zfpm1 C T 8: 123,061,308 (GRCm39) T291M probably benign Het
Zkscan8 A G 13: 21,710,702 (GRCm39) V136A probably benign Het
Zscan18 A G 7: 12,505,612 (GRCm39) Y592H probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTACACGGCCCAATC -3'
(R):5'- AGCGGCCATCTTGAGGTTAG -3'

Sequencing Primer
(F):5'- GATGTACACGGCCCAATCCTCTC -3'
(R):5'- TTAGGAACCCTGGCCTGG -3'
Posted On 2022-04-18