Incidental Mutation 'R9342:Celsr2'
ID 707546
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms mfmi1, EGFL2, flamingo
MMRRC Submission
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108390851-108415552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108413126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 790 (N790I)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000090558
AA Change: N790I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: N790I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,142,411 T52S possibly damaging Het
A330070K13Rik T C 5: 130,379,035 I112V unknown Het
Aars2 A G 17: 45,507,076 N75D possibly damaging Het
Abcf2 G A 5: 24,573,477 R228C probably benign Het
Agfg2 A G 5: 137,653,852 L415P probably benign Het
Alpi A G 1: 87,098,664 L535P unknown Het
Anxa9 T G 3: 95,303,048 T69P probably damaging Het
Arrb2 T A 11: 70,436,637 D79E probably benign Het
Bcat1 A G 6: 145,048,606 V55A probably benign Het
Cacna1c A G 6: 119,057,374 L64P Het
Cd247 A T 1: 165,855,190 D28V probably damaging Het
Clrn1 C T 3: 58,884,830 V71I probably benign Het
Cmtr2 T C 8: 110,222,446 Y463H possibly damaging Het
Col6a6 T C 9: 105,785,973 T122A probably benign Het
Cubn T A 2: 13,458,956 D646V probably damaging Het
Dab2ip T A 2: 35,723,093 L1062Q possibly damaging Het
Dnajb4 T C 3: 152,186,635 N187S probably benign Het
Dock10 A T 1: 80,592,643 F365L probably benign Het
Erich6 G A 3: 58,626,680 Q309* probably null Het
Ext1 T C 15: 53,345,128 H79R probably benign Het
Fam155a C A 8: 9,771,006 A5S probably damaging Het
Fam187b T A 7: 30,977,760 C231* probably null Het
Fbxo15 T A 18: 84,965,484 M319K unknown Het
Fbxo18 T C 2: 11,749,603 I775V probably benign Het
Fbxo9 A T 9: 78,095,238 M187K possibly damaging Het
Fer1l4 T C 2: 156,035,276 D1113G probably benign Het
Fsip2 A T 2: 82,988,403 T4827S possibly damaging Het
Gm49398 A T 13: 61,287,664 L7Q probably damaging Het
H2-M10.4 A T 17: 36,460,393 W298R probably damaging Het
Hoxd10 A G 2: 74,692,638 E220G probably benign Het
Hrh2 T G 13: 54,214,203 L66R probably damaging Het
Igf1r A G 7: 68,194,998 T840A probably benign Het
Iqca A G 1: 90,144,966 V64A probably damaging Het
Klc2 A G 19: 5,108,631 S612P probably benign Het
Klf15 A G 6: 90,466,869 E142G probably damaging Het
Krt40 T A 11: 99,538,753 T332S probably damaging Het
Lrrc9 T C 12: 72,459,993 F348S probably damaging Het
Lrrn4 T C 2: 132,870,370 D511G probably benign Het
Lrtm2 T C 6: 119,320,973 I36V probably benign Het
Lsm10 T C 4: 126,098,067 L72P probably damaging Het
Mab21l3 T A 3: 101,835,203 S14C possibly damaging Het
Map2k4 T C 11: 65,690,743 K381R probably benign Het
Mcidas A G 13: 112,994,381 D80G probably damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mga A G 2: 119,948,175 D2067G probably benign Het
Msc G T 1: 14,755,483 P89Q probably benign Het
Olfr1086 A T 2: 86,677,150 L61Q probably damaging Het
Olfr301 A G 7: 86,413,222 I287V probably benign Het
Olfr709-ps1 A T 7: 106,927,357 I34N possibly damaging Het
Plekhg6 T C 6: 125,363,060 D779G probably damaging Het
Pnpla2 C A 7: 141,455,418 Y44* probably null Het
Ppp1r17 T A 6: 56,026,539 D112E probably damaging Het
Prdm2 A G 4: 143,134,908 I604T probably damaging Het
Prkce A G 17: 86,474,449 Y182C probably damaging Het
Prokr2 G A 2: 132,340,870 S189F possibly damaging Het
Qser1 A T 2: 104,787,819 S793T probably benign Het
Reck T C 4: 43,943,301 F951S probably benign Het
Rev3l T C 10: 39,821,462 S652P probably benign Het
Rtl1 A C 12: 109,592,450 L985R probably damaging Het
Sardh T C 2: 27,230,857 E385G possibly damaging Het
Sfmbt1 G T 14: 30,797,642 W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 C683* probably null Het
Slc51a A G 16: 32,479,699 L80P possibly damaging Het
Slco3a1 C A 7: 74,504,289 L178F probably damaging Het
Spata6 T A 4: 111,779,192 C227S possibly damaging Het
Tbc1d30 A T 10: 121,267,461 Y555* probably null Het
Tcf7l2 A G 19: 55,743,085 Q90R probably benign Het
Tff3 A C 17: 31,127,449 S50A probably benign Het
Tnrc6c T C 11: 117,739,894 M1027T probably benign Het
Ttc12 A G 9: 49,440,380 F606L probably benign Het
Uqcc3 G A 19: 8,880,726 Q34* probably null Het
Veph1 T A 3: 66,244,538 I157F probably damaging Het
Vmn2r14 G A 5: 109,220,562 T188I probably damaging Het
Vmn2r67 A G 7: 85,136,580 I739T probably benign Het
Vmn2r68 A G 7: 85,233,785 F253S probably benign Het
Vmn2r74 T C 7: 85,957,416 I241V probably benign Het
Vmn2r97 A G 17: 18,929,106 E252G probably benign Het
Vps13b T C 15: 35,455,054 V703A possibly damaging Het
Vps25 T A 11: 101,258,797 L149Q probably damaging Het
Xirp1 T C 9: 120,016,884 T978A probably benign Het
Xpnpep1 T A 19: 53,004,817 I360F probably benign Het
Zfpm1 C T 8: 122,334,569 T291M probably benign Het
Zkscan8 A G 13: 21,526,532 V136A probably benign Het
Zscan18 A G 7: 12,771,685 Y592H probably damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
barrow UTSW 3 108394965 missense possibly damaging 0.92
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
R7062:Celsr2 UTSW 3 108402510 missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108397865 missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108415359 missense unknown
R7326:Celsr2 UTSW 3 108394995 missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108402457 missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108413090 missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R7613:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108413490 missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108398588 missense probably benign
R7687:Celsr2 UTSW 3 108397769 missense probably benign 0.27
R7695:Celsr2 UTSW 3 108402753 missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108403969 missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108412655 missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108396455 missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108413531 missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108395636 missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108392633 makesense probably null
R8435:Celsr2 UTSW 3 108414399 missense probably benign
R8438:Celsr2 UTSW 3 108393823 missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8460:Celsr2 UTSW 3 108396777 missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108412851 nonsense probably null
R8479:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8480:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8512:Celsr2 UTSW 3 108413838 missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108406860 missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108397073 missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108396127 splice site probably benign
R8888:Celsr2 UTSW 3 108413564 missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108413564 missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108396566 missense probably benign 0.00
R9119:Celsr2 UTSW 3 108401972 missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108402546 missense probably benign 0.04
R9209:Celsr2 UTSW 3 108414033 missense probably benign 0.02
R9416:Celsr2 UTSW 3 108414768 missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108393758 missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108414518 missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108415262 missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108401599 missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108394235 missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108393131 missense probably benign 0.10
Z1176:Celsr2 UTSW 3 108412341 missense probably benign 0.07
Z1177:Celsr2 UTSW 3 108412220 missense probably damaging 1.00
Z1177:Celsr2 UTSW 3 108413571 missense probably benign 0.32
Z1191:Celsr2 UTSW 3 108414549 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGGTGTAGAAAACCCTGCCATTC -3'
(R):5'- GTTAATGAAGACCGGCCAGC -3'

Sequencing Primer
(F):5'- TGCCATTCAGACCGGAGTC -3'
(R):5'- AGCAGGCACCACAGTGG -3'
Posted On 2022-04-18