Incidental Mutation 'R9342:Igf1r'
ID 707564
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67844746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 840 (T840A)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005671
AA Change: T840A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: T840A

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik T C 5: 130,407,876 (GRCm39) I112V unknown Het
Aars2 A G 17: 45,818,002 (GRCm39) N75D possibly damaging Het
Abcf2 G A 5: 24,778,475 (GRCm39) R228C probably benign Het
Agfg2 A G 5: 137,652,114 (GRCm39) L415P probably benign Het
Alpi A G 1: 87,026,386 (GRCm39) L535P unknown Het
Anxa9 T G 3: 95,210,359 (GRCm39) T69P probably damaging Het
Arrb2 T A 11: 70,327,463 (GRCm39) D79E probably benign Het
Bcat1 A G 6: 144,994,332 (GRCm39) V55A probably benign Het
Cacna1c A G 6: 119,034,335 (GRCm39) L64P Het
Cd247 A T 1: 165,682,759 (GRCm39) D28V probably damaging Het
Celsr2 T A 3: 108,320,442 (GRCm39) N790I probably damaging Het
Clrn1 C T 3: 58,792,251 (GRCm39) V71I probably benign Het
Cmtr2 T C 8: 110,949,078 (GRCm39) Y463H possibly damaging Het
Col6a6 T C 9: 105,663,172 (GRCm39) T122A probably benign Het
Cubn T A 2: 13,463,767 (GRCm39) D646V probably damaging Het
Dab2ip T A 2: 35,613,105 (GRCm39) L1062Q possibly damaging Het
Dnajb4 T C 3: 151,892,272 (GRCm39) N187S probably benign Het
Dock10 A T 1: 80,570,360 (GRCm39) F365L probably benign Het
Erich6 G A 3: 58,534,101 (GRCm39) Q309* probably null Het
Ext1 T C 15: 53,208,524 (GRCm39) H79R probably benign Het
Fam187b T A 7: 30,677,185 (GRCm39) C231* probably null Het
Fbh1 T C 2: 11,754,414 (GRCm39) I775V probably benign Het
Fbxo15 T A 18: 84,983,609 (GRCm39) M319K unknown Het
Fbxo9 A T 9: 78,002,520 (GRCm39) M187K possibly damaging Het
Fer1l4 T C 2: 155,877,196 (GRCm39) D1113G probably benign Het
Fsip2 A T 2: 82,818,747 (GRCm39) T4827S possibly damaging Het
Gm49398 A T 13: 61,435,478 (GRCm39) L7Q probably damaging Het
H2-M10.4 A T 17: 36,771,285 (GRCm39) W298R probably damaging Het
Hoxd10 A G 2: 74,522,982 (GRCm39) E220G probably benign Het
Hrh2 T G 13: 54,368,222 (GRCm39) L66R probably damaging Het
Iqca1 A G 1: 90,072,688 (GRCm39) V64A probably damaging Het
Klc2 A G 19: 5,158,659 (GRCm39) S612P probably benign Het
Klf15 A G 6: 90,443,851 (GRCm39) E142G probably damaging Het
Krt40 T A 11: 99,429,579 (GRCm39) T332S probably damaging Het
Lrrc9 T C 12: 72,506,767 (GRCm39) F348S probably damaging Het
Lrrn4 T C 2: 132,712,290 (GRCm39) D511G probably benign Het
Lrtm2 T C 6: 119,297,934 (GRCm39) I36V probably benign Het
Lsm10 T C 4: 125,991,860 (GRCm39) L72P probably damaging Het
Mab21l3 T A 3: 101,742,519 (GRCm39) S14C possibly damaging Het
Map2k4 T C 11: 65,581,569 (GRCm39) K381R probably benign Het
Mcidas A G 13: 113,130,915 (GRCm39) D80G probably damaging Het
Med23 A G 10: 24,750,469 (GRCm39) M99V probably benign Het
Mga A G 2: 119,778,656 (GRCm39) D2067G probably benign Het
Ms4a19 T A 19: 11,119,775 (GRCm39) T52S possibly damaging Het
Msc G T 1: 14,825,707 (GRCm39) P89Q probably benign Het
Nalf1 C A 8: 9,821,006 (GRCm39) A5S probably damaging Het
Or14c44 A G 7: 86,062,430 (GRCm39) I287V probably benign Het
Or2d3c A T 7: 106,526,564 (GRCm39) I34N possibly damaging Het
Or5t7 A T 2: 86,507,494 (GRCm39) L61Q probably damaging Het
Plekhg6 T C 6: 125,340,023 (GRCm39) D779G probably damaging Het
Pnpla2 C A 7: 141,035,331 (GRCm39) Y44* probably null Het
Ppp1r17 T A 6: 56,003,524 (GRCm39) D112E probably damaging Het
Prdm2 A G 4: 142,861,478 (GRCm39) I604T probably damaging Het
Prkce A G 17: 86,781,877 (GRCm39) Y182C probably damaging Het
Prokr2 G A 2: 132,182,790 (GRCm39) S189F possibly damaging Het
Qser1 A T 2: 104,618,164 (GRCm39) S793T probably benign Het
Reck T C 4: 43,943,301 (GRCm39) F951S probably benign Het
Rev3l T C 10: 39,697,458 (GRCm39) S652P probably benign Het
Rtl1 A C 12: 109,558,884 (GRCm39) L985R probably damaging Het
Sardh T C 2: 27,120,869 (GRCm39) E385G possibly damaging Het
Sfmbt1 G T 14: 30,519,599 (GRCm39) W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 (GRCm38) C683* probably null Het
Slc51a A G 16: 32,298,517 (GRCm39) L80P possibly damaging Het
Slco3a1 C A 7: 74,154,037 (GRCm39) L178F probably damaging Het
Spata6 T A 4: 111,636,389 (GRCm39) C227S possibly damaging Het
Tbc1d30 A T 10: 121,103,366 (GRCm39) Y555* probably null Het
Tcf7l2 A G 19: 55,731,517 (GRCm39) Q90R probably benign Het
Tff3 A C 17: 31,346,423 (GRCm39) S50A probably benign Het
Tnrc6c T C 11: 117,630,720 (GRCm39) M1027T probably benign Het
Ttc12 A G 9: 49,351,680 (GRCm39) F606L probably benign Het
Uqcc3 G A 19: 8,858,090 (GRCm39) Q34* probably null Het
Veph1 T A 3: 66,151,959 (GRCm39) I157F probably damaging Het
Vmn2r14 G A 5: 109,368,428 (GRCm39) T188I probably damaging Het
Vmn2r67 A G 7: 84,785,788 (GRCm39) I739T probably benign Het
Vmn2r68 A G 7: 84,882,993 (GRCm39) F253S probably benign Het
Vmn2r74 T C 7: 85,606,624 (GRCm39) I241V probably benign Het
Vmn2r97 A G 17: 19,149,368 (GRCm39) E252G probably benign Het
Vps13b T C 15: 35,455,200 (GRCm39) V703A possibly damaging Het
Vps25 T A 11: 101,149,623 (GRCm39) L149Q probably damaging Het
Xirp1 T C 9: 119,845,950 (GRCm39) T978A probably benign Het
Xpnpep1 T A 19: 52,993,248 (GRCm39) I360F probably benign Het
Zfpm1 C T 8: 123,061,308 (GRCm39) T291M probably benign Het
Zkscan8 A G 13: 21,710,702 (GRCm39) V136A probably benign Het
Zscan18 A G 7: 12,505,612 (GRCm39) Y592H probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1104:Igf1r UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R1962:Igf1r UTSW 7 67,857,023 (GRCm39) missense probably damaging 0.99
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5510:Igf1r UTSW 7 67,843,107 (GRCm39) missense probably benign 0.19
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7442:Igf1r UTSW 7 67,823,026 (GRCm39) missense probably damaging 1.00
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8539:Igf1r UTSW 7 67,653,596 (GRCm39) missense probably benign 0.06
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9727:Igf1r UTSW 7 67,857,554 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AACTCCTACAAGGTCCCCTG -3'
(R):5'- GGAAGACCTTTATCCTTCCCG -3'

Sequencing Primer
(F):5'- CTGTCCAGAGTCCTGTATATACAAGG -3'
(R):5'- AGACAACCAGTATGCCATAGC -3'
Posted On 2022-04-18