Incidental Mutation 'R9342:Rev3l'
ID 707580
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene Name REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms Sez4, Rev
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 39732118-39875211 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39821462 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 652 (S652P)
Ref Sequence ENSEMBL: ENSMUSP00000019986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
AlphaFold no structure available at present
PDB Structure Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: S652P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: S652P

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: S652P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: S652P

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,142,411 T52S possibly damaging Het
A330070K13Rik T C 5: 130,379,035 I112V unknown Het
Aars2 A G 17: 45,507,076 N75D possibly damaging Het
Abcf2 G A 5: 24,573,477 R228C probably benign Het
Agfg2 A G 5: 137,653,852 L415P probably benign Het
Alpi A G 1: 87,098,664 L535P unknown Het
Anxa9 T G 3: 95,303,048 T69P probably damaging Het
Arrb2 T A 11: 70,436,637 D79E probably benign Het
Bcat1 A G 6: 145,048,606 V55A probably benign Het
Cacna1c A G 6: 119,057,374 L64P Het
Cd247 A T 1: 165,855,190 D28V probably damaging Het
Celsr2 T A 3: 108,413,126 N790I probably damaging Het
Clrn1 C T 3: 58,884,830 V71I probably benign Het
Cmtr2 T C 8: 110,222,446 Y463H possibly damaging Het
Col6a6 T C 9: 105,785,973 T122A probably benign Het
Cubn T A 2: 13,458,956 D646V probably damaging Het
Dab2ip T A 2: 35,723,093 L1062Q possibly damaging Het
Dnajb4 T C 3: 152,186,635 N187S probably benign Het
Dock10 A T 1: 80,592,643 F365L probably benign Het
Erich6 G A 3: 58,626,680 Q309* probably null Het
Ext1 T C 15: 53,345,128 H79R probably benign Het
Fam155a C A 8: 9,771,006 A5S probably damaging Het
Fam187b T A 7: 30,977,760 C231* probably null Het
Fbxo15 T A 18: 84,965,484 M319K unknown Het
Fbxo18 T C 2: 11,749,603 I775V probably benign Het
Fbxo9 A T 9: 78,095,238 M187K possibly damaging Het
Fer1l4 T C 2: 156,035,276 D1113G probably benign Het
Fsip2 A T 2: 82,988,403 T4827S possibly damaging Het
Gm49398 A T 13: 61,287,664 L7Q probably damaging Het
H2-M10.4 A T 17: 36,460,393 W298R probably damaging Het
Hoxd10 A G 2: 74,692,638 E220G probably benign Het
Hrh2 T G 13: 54,214,203 L66R probably damaging Het
Igf1r A G 7: 68,194,998 T840A probably benign Het
Iqca A G 1: 90,144,966 V64A probably damaging Het
Klc2 A G 19: 5,108,631 S612P probably benign Het
Klf15 A G 6: 90,466,869 E142G probably damaging Het
Krt40 T A 11: 99,538,753 T332S probably damaging Het
Lrrc9 T C 12: 72,459,993 F348S probably damaging Het
Lrrn4 T C 2: 132,870,370 D511G probably benign Het
Lrtm2 T C 6: 119,320,973 I36V probably benign Het
Lsm10 T C 4: 126,098,067 L72P probably damaging Het
Mab21l3 T A 3: 101,835,203 S14C possibly damaging Het
Map2k4 T C 11: 65,690,743 K381R probably benign Het
Mcidas A G 13: 112,994,381 D80G probably damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mga A G 2: 119,948,175 D2067G probably benign Het
Msc G T 1: 14,755,483 P89Q probably benign Het
Olfr1086 A T 2: 86,677,150 L61Q probably damaging Het
Olfr301 A G 7: 86,413,222 I287V probably benign Het
Olfr709-ps1 A T 7: 106,927,357 I34N possibly damaging Het
Plekhg6 T C 6: 125,363,060 D779G probably damaging Het
Pnpla2 C A 7: 141,455,418 Y44* probably null Het
Ppp1r17 T A 6: 56,026,539 D112E probably damaging Het
Prdm2 A G 4: 143,134,908 I604T probably damaging Het
Prkce A G 17: 86,474,449 Y182C probably damaging Het
Prokr2 G A 2: 132,340,870 S189F possibly damaging Het
Qser1 A T 2: 104,787,819 S793T probably benign Het
Reck T C 4: 43,943,301 F951S probably benign Het
Rtl1 A C 12: 109,592,450 L985R probably damaging Het
Sardh T C 2: 27,230,857 E385G possibly damaging Het
Sfmbt1 G T 14: 30,797,642 W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 C683* probably null Het
Slc51a A G 16: 32,479,699 L80P possibly damaging Het
Slco3a1 C A 7: 74,504,289 L178F probably damaging Het
Spata6 T A 4: 111,779,192 C227S possibly damaging Het
Tbc1d30 A T 10: 121,267,461 Y555* probably null Het
Tcf7l2 A G 19: 55,743,085 Q90R probably benign Het
Tff3 A C 17: 31,127,449 S50A probably benign Het
Tnrc6c T C 11: 117,739,894 M1027T probably benign Het
Ttc12 A G 9: 49,440,380 F606L probably benign Het
Uqcc3 G A 19: 8,880,726 Q34* probably null Het
Veph1 T A 3: 66,244,538 I157F probably damaging Het
Vmn2r14 G A 5: 109,220,562 T188I probably damaging Het
Vmn2r67 A G 7: 85,136,580 I739T probably benign Het
Vmn2r68 A G 7: 85,233,785 F253S probably benign Het
Vmn2r74 T C 7: 85,957,416 I241V probably benign Het
Vmn2r97 A G 17: 18,929,106 E252G probably benign Het
Vps13b T C 15: 35,455,054 V703A possibly damaging Het
Vps25 T A 11: 101,258,797 L149Q probably damaging Het
Xirp1 T C 9: 120,016,884 T978A probably benign Het
Xpnpep1 T A 19: 53,004,817 I360F probably benign Het
Zfpm1 C T 8: 122,334,569 T291M probably benign Het
Zkscan8 A G 13: 21,526,532 V136A probably benign Het
Zscan18 A G 7: 12,771,685 Y592H probably damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
R7575:Rev3l UTSW 10 39821445 missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R7597:Rev3l UTSW 10 39822884 missense probably damaging 1.00
R7670:Rev3l UTSW 10 39836722 missense probably benign 0.01
R7804:Rev3l UTSW 10 39823485 missense probably benign 0.34
R7818:Rev3l UTSW 10 39823902 missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R7991:Rev3l UTSW 10 39863738 missense possibly damaging 0.52
R8059:Rev3l UTSW 10 39843495 missense probably damaging 1.00
R8174:Rev3l UTSW 10 39859115 missense probably damaging 1.00
R8187:Rev3l UTSW 10 39806697 missense probably benign
R8299:Rev3l UTSW 10 39821541 missense probably benign 0.01
R8352:Rev3l UTSW 10 39822903 missense probably damaging 1.00
R8452:Rev3l UTSW 10 39822903 missense probably damaging 1.00
R8468:Rev3l UTSW 10 39827991 missense probably damaging 0.99
R8487:Rev3l UTSW 10 39806848 missense probably damaging 1.00
R8512:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R8554:Rev3l UTSW 10 39806842 missense probably benign 0.12
R8702:Rev3l UTSW 10 39838469 nonsense probably null
R8848:Rev3l UTSW 10 39846709 missense probably damaging 0.99
R8857:Rev3l UTSW 10 39794969 nonsense probably null
R8870:Rev3l UTSW 10 39862790 missense probably damaging 1.00
R9094:Rev3l UTSW 10 39824813 missense probably benign
R9175:Rev3l UTSW 10 39854768 missense possibly damaging 0.83
R9286:Rev3l UTSW 10 39806951 missense possibly damaging 0.54
R9299:Rev3l UTSW 10 39848003 missense probably damaging 1.00
R9307:Rev3l UTSW 10 39817153 missense probably benign 0.01
R9337:Rev3l UTSW 10 39822854 missense probably benign 0.40
R9389:Rev3l UTSW 10 39822971 missense possibly damaging 0.47
R9395:Rev3l UTSW 10 39859223 critical splice donor site probably null
R9458:Rev3l UTSW 10 39783251 missense probably damaging 1.00
R9481:Rev3l UTSW 10 39825037 missense probably benign
R9646:Rev3l UTSW 10 39822444 missense probably damaging 1.00
R9686:Rev3l UTSW 10 39867388 missense possibly damaging 0.67
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGTTTAACTGAAGACCTTTCACAACC -3'
(R):5'- ACACCACTGAGAGATGTGCTG -3'

Sequencing Primer
(F):5'- CCAAACAGTACAGAAAAAGGTCG -3'
(R):5'- ACCACTGAGAGATGTGCTGTTTCC -3'
Posted On 2022-04-18