Incidental Mutation 'R9342:Tnrc6c'
ID 707586
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Name trinucleotide repeat containing 6C
Synonyms 9930033H14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117654289-117763439 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117739894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1027 (M1027T)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026658
AA Change: M1187T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: M1187T

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106344
AA Change: M1187T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: M1187T

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138299
AA Change: M1027T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: M1027T

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T A 19: 11,142,411 T52S possibly damaging Het
A330070K13Rik T C 5: 130,379,035 I112V unknown Het
Aars2 A G 17: 45,507,076 N75D possibly damaging Het
Abcf2 G A 5: 24,573,477 R228C probably benign Het
Agfg2 A G 5: 137,653,852 L415P probably benign Het
Alpi A G 1: 87,098,664 L535P unknown Het
Anxa9 T G 3: 95,303,048 T69P probably damaging Het
Arrb2 T A 11: 70,436,637 D79E probably benign Het
Bcat1 A G 6: 145,048,606 V55A probably benign Het
Cacna1c A G 6: 119,057,374 L64P Het
Cd247 A T 1: 165,855,190 D28V probably damaging Het
Celsr2 T A 3: 108,413,126 N790I probably damaging Het
Clrn1 C T 3: 58,884,830 V71I probably benign Het
Cmtr2 T C 8: 110,222,446 Y463H possibly damaging Het
Col6a6 T C 9: 105,785,973 T122A probably benign Het
Cubn T A 2: 13,458,956 D646V probably damaging Het
Dab2ip T A 2: 35,723,093 L1062Q possibly damaging Het
Dnajb4 T C 3: 152,186,635 N187S probably benign Het
Dock10 A T 1: 80,592,643 F365L probably benign Het
Erich6 G A 3: 58,626,680 Q309* probably null Het
Ext1 T C 15: 53,345,128 H79R probably benign Het
Fam155a C A 8: 9,771,006 A5S probably damaging Het
Fam187b T A 7: 30,977,760 C231* probably null Het
Fbxo15 T A 18: 84,965,484 M319K unknown Het
Fbxo18 T C 2: 11,749,603 I775V probably benign Het
Fbxo9 A T 9: 78,095,238 M187K possibly damaging Het
Fer1l4 T C 2: 156,035,276 D1113G probably benign Het
Fsip2 A T 2: 82,988,403 T4827S possibly damaging Het
Gm49398 A T 13: 61,287,664 L7Q probably damaging Het
H2-M10.4 A T 17: 36,460,393 W298R probably damaging Het
Hoxd10 A G 2: 74,692,638 E220G probably benign Het
Hrh2 T G 13: 54,214,203 L66R probably damaging Het
Igf1r A G 7: 68,194,998 T840A probably benign Het
Iqca A G 1: 90,144,966 V64A probably damaging Het
Klc2 A G 19: 5,108,631 S612P probably benign Het
Klf15 A G 6: 90,466,869 E142G probably damaging Het
Krt40 T A 11: 99,538,753 T332S probably damaging Het
Lrrc9 T C 12: 72,459,993 F348S probably damaging Het
Lrrn4 T C 2: 132,870,370 D511G probably benign Het
Lrtm2 T C 6: 119,320,973 I36V probably benign Het
Lsm10 T C 4: 126,098,067 L72P probably damaging Het
Mab21l3 T A 3: 101,835,203 S14C possibly damaging Het
Map2k4 T C 11: 65,690,743 K381R probably benign Het
Mcidas A G 13: 112,994,381 D80G probably damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mga A G 2: 119,948,175 D2067G probably benign Het
Msc G T 1: 14,755,483 P89Q probably benign Het
Olfr1086 A T 2: 86,677,150 L61Q probably damaging Het
Olfr301 A G 7: 86,413,222 I287V probably benign Het
Olfr709-ps1 A T 7: 106,927,357 I34N possibly damaging Het
Plekhg6 T C 6: 125,363,060 D779G probably damaging Het
Pnpla2 C A 7: 141,455,418 Y44* probably null Het
Ppp1r17 T A 6: 56,026,539 D112E probably damaging Het
Prdm2 A G 4: 143,134,908 I604T probably damaging Het
Prkce A G 17: 86,474,449 Y182C probably damaging Het
Prokr2 G A 2: 132,340,870 S189F possibly damaging Het
Qser1 A T 2: 104,787,819 S793T probably benign Het
Reck T C 4: 43,943,301 F951S probably benign Het
Rev3l T C 10: 39,821,462 S652P probably benign Het
Rtl1 A C 12: 109,592,450 L985R probably damaging Het
Sardh T C 2: 27,230,857 E385G possibly damaging Het
Sfmbt1 G T 14: 30,797,642 W440L possibly damaging Het
Slc4a7 T A 14: 14,772,541 C683* probably null Het
Slc51a A G 16: 32,479,699 L80P possibly damaging Het
Slco3a1 C A 7: 74,504,289 L178F probably damaging Het
Spata6 T A 4: 111,779,192 C227S possibly damaging Het
Tbc1d30 A T 10: 121,267,461 Y555* probably null Het
Tcf7l2 A G 19: 55,743,085 Q90R probably benign Het
Tff3 A C 17: 31,127,449 S50A probably benign Het
Ttc12 A G 9: 49,440,380 F606L probably benign Het
Uqcc3 G A 19: 8,880,726 Q34* probably null Het
Veph1 T A 3: 66,244,538 I157F probably damaging Het
Vmn2r14 G A 5: 109,220,562 T188I probably damaging Het
Vmn2r67 A G 7: 85,136,580 I739T probably benign Het
Vmn2r68 A G 7: 85,233,785 F253S probably benign Het
Vmn2r74 T C 7: 85,957,416 I241V probably benign Het
Vmn2r97 A G 17: 18,929,106 E252G probably benign Het
Vps13b T C 15: 35,455,054 V703A possibly damaging Het
Vps25 T A 11: 101,258,797 L149Q probably damaging Het
Xirp1 T C 9: 120,016,884 T978A probably benign Het
Xpnpep1 T A 19: 53,004,817 I360F probably benign Het
Zfpm1 C T 8: 122,334,569 T291M probably benign Het
Zkscan8 A G 13: 21,526,532 V136A probably benign Het
Zscan18 A G 7: 12,771,685 Y592H probably damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
R7755:Tnrc6c UTSW 11 117758086 missense probably benign 0.00
R8679:Tnrc6c UTSW 11 117714135 missense probably benign
R8824:Tnrc6c UTSW 11 117739854 splice site probably benign
R8971:Tnrc6c UTSW 11 117749263 missense possibly damaging 0.95
R9261:Tnrc6c UTSW 11 117714279 missense probably damaging 0.99
R9283:Tnrc6c UTSW 11 117700804 missense unknown
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117732177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGTTTCCTAAGGGCTGGCAAG -3'
(R):5'- TTTCCATCTGACTTGCTTTAAGGAC -3'

Sequencing Primer
(F):5'- TAAGGGCTGGCAAGAGCGTG -3'
(R):5'- GACTTGCTTTAAGGACACAGCTCAG -3'
Posted On 2022-04-18